View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2600_low_27 (Length: 271)
Name: NF2600_low_27
Description: NF2600
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2600_low_27 |
 |  |
|
| [»] scaffold0008 (2 HSPs) |
 |  |  |
|
Alignment Details
Target: chr1 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 1 - 255
Target Start/End: Complemental strand, 31523481 - 31523227
Alignment:
| Q |
1 |
acaatctagaatgttggttaactatacaatcttgagattttccagaaaatttctgaatttgtgataggccctttagggttcttttacatacttgtattat |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
31523481 |
acaatctagaatgttggttaactatacaatcttgagattttccagaaaatttctgaatttgtgataggcactttagggttcttttacatacttgtattat |
31523382 |
T |
 |
| Q |
101 |
gtgaaacaatatctgattagtccttggattaatccttctagggctgaataccgagttttcaaaacnnnnnnntacaacacaattgaaaaaatgtatcaga |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||| |
|
|
| T |
31523381 |
gtgaaacaatatctgattagtccttggattaatccttctagggctgaataccgagtttccaaaacaaaaaaatacaacacaattgaaaaaatgtatcaga |
31523282 |
T |
 |
| Q |
201 |
tacatcaactgcaaaaatgtatcagaaaatagataaattaccggaaacagaataa |
255 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
31523281 |
tacatcaactgcaaaaatgtattagaaaatagataaattaccggaaacagaataa |
31523227 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0008 (Bit Score: 41; Significance: 0.00000000000003; HSPs: 2)
Name: scaffold0008
Description:
Target: scaffold0008; HSP #1
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 1 - 65
Target Start/End: Original strand, 52062 - 52126
Alignment:
| Q |
1 |
acaatctagaatgttggttaactatacaatcttgagattttccagaaaatttctgaatttgtgat |
65 |
Q |
| |
|
|||||||| ||||||||| ||| ||||||| |||||| |||||||||||||||| |||||||||| |
|
|
| T |
52062 |
acaatctaaaatgttggtaaacaatacaatattgagaatttccagaaaatttcttaatttgtgat |
52126 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0008; HSP #2
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 207 - 255
Target Start/End: Original strand, 52303 - 52351
Alignment:
| Q |
207 |
aactgcaaaaatgtatcagaaaatagataaattaccggaaacagaataa |
255 |
Q |
| |
|
||||| |||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
52303 |
aactgaaaaaatgtataggaaaatagataaattaccggaaacagaataa |
52351 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University