View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2601_high_4 (Length: 274)
Name: NF2601_high_4
Description: NF2601
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2601_high_4 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 209; Significance: 1e-114; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 18 - 238
Target Start/End: Original strand, 43927014 - 43927234
Alignment:
| Q |
18 |
cctagcatagcataagtgtctccaagttgcatgtgactggcgaatttcgcaatggcatgttgctcgccttcctcaacgacaggaatttcgattgatcgct |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||| ||||||||||||||||||||| |
|
|
| T |
43927014 |
cctagcatagcataagtgtctccaagttgcatgtgactggcgaatttcgcaatagcatgttgcttgccttcctcaacggcaggaatttcgattgatcgct |
43927113 |
T |
 |
| Q |
118 |
ctaaaattggaattgcctcattataatgacccaaactgcaatatattgctgcagtaacatgtaaacacataaccagatccaaactcggtttcccattcgc |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43927114 |
ctaaaattggaattgcctcattataatgacccaaactgcaatatattgctgcagtaacatgtaaacacataaccagatccaaactcggtttcccattcgc |
43927213 |
T |
 |
| Q |
218 |
agatttctcaaacaatttcgt |
238 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
43927214 |
agatttctcaaacaatttcgt |
43927234 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 232 - 272
Target Start/End: Complemental strand, 43927285 - 43927245
Alignment:
| Q |
232 |
atttcgttaggagagaacccgaggaaagctctcgagttatc |
272 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43927285 |
atttcgttaggagagaacccgaggaaagctctcgagttatc |
43927245 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 66; Significance: 3e-29; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 23 - 236
Target Start/End: Original strand, 35115999 - 35116212
Alignment:
| Q |
23 |
catagcataagtgtctccaagttgcatgtgactggcgaatttcgcaatggcatgttgctcgccttcctcaacgacaggaatttcgattgatcgctctaaa |
122 |
Q |
| |
|
||||||||| |||||||||||||||||||||| ||| ||||| |||| ||||| || | | |||| | | ||||||| || || || ||||| | | |
|
|
| T |
35115999 |
catagcataggtgtctccaagttgcatgtgaccggcaaatttagcaagagcatgctgttgactttccccgatatcaggaatctcaatcgaacgctcaaga |
35116098 |
T |
 |
| Q |
123 |
attggaattgcctcattataatgacccaaactgcaatatattgctgcagtaacatgtaaacacataaccagatccaaactcggtttcccattcgcagatt |
222 |
Q |
| |
|
|| ||||||||||| |||| |||||| ||||||||||||||||| ||||||||||||||||||||||| ||||||||||| |||||||| || | | |
|
|
| T |
35116099 |
atgggaattgcctcgctatatcgacccaggctgcaatatattgctgcggtaacatgtaaacacataaccagttccaaactcggcttcccattgccaaact |
35116198 |
T |
 |
| Q |
223 |
tctcaaacaatttc |
236 |
Q |
| |
|
||||||||| |||| |
|
|
| T |
35116199 |
tctcaaacagtttc |
35116212 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University