View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2601_low_1 (Length: 424)
Name: NF2601_low_1
Description: NF2601
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2601_low_1 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 301; Significance: 1e-169; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 301; E-Value: 1e-169
Query Start/End: Original strand, 41 - 408
Target Start/End: Original strand, 38189153 - 38189541
Alignment:
| Q |
41 |
aacagaagggcattcagagtgtttagtttttatgttggttcagcataacaggttttagtatatgatggacaagaagcagcatcatttata---------- |
130 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38189153 |
aacagaagggcattcagagtgtttagtttttatgttggtgcagcataacaggttttagtatatgatggacaagaagcagcatcatttatagttgtttctg |
38189252 |
T |
|
| Q |
131 |
-----------gatattgcagagtgaaagaatctttggcatgccttataatactcatgaaacgggccggtgtttttggtgcgtctgttttggtgccgcgc |
219 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
38189253 |
ctgatgatatagatattgcagagtgaaagaatctttggtatgccttataatattcatgaaacgggccggtgtttttggtgcgtctgttttggtgctgcgc |
38189352 |
T |
|
| Q |
220 |
tgtgtggttatcatgttcatctaacttgtatatatacttttcatttggctattctttagtacaacttgcaatgaagtttagtctcatttctttagaaaat |
319 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38189353 |
tgtgtggttatcatgttcatctaacttgtatatatacttttcatttggctattctttagtacaacttgcaatgaagtttagtctcatttctttagaaaat |
38189452 |
T |
|
| Q |
320 |
tcttttgtttaccgaaaacaatcaacatgaagctaagaaaacaatatttatatatgataagaagcaaattacatttacaagtcactagt |
408 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38189453 |
tcttttgtttaccgaaaacaatcaacatgaagctaagaaaacaatatttctatatgataagaagcaaattacatttacaagtcactagt |
38189541 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University