View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2602_high_27 (Length: 316)
Name: NF2602_high_27
Description: NF2602
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2602_high_27 |
 |  |
|
| [»] scaffold0148 (1 HSPs) |
 |  |  |
|
| [»] scaffold0280 (2 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0148 (Bit Score: 239; Significance: 1e-132; HSPs: 1)
Name: scaffold0148
Description:
Target: scaffold0148; HSP #1
Raw Score: 239; E-Value: 1e-132
Query Start/End: Original strand, 19 - 303
Target Start/End: Complemental strand, 27694 - 27410
Alignment:
| Q |
19 |
atatgctcaggtccctgataagcagctgcgtggtcttattccttcaaactgttggatctggacacaaagtttaactactcttaaagaagagtatactagt |
118 |
Q |
| |
|
||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
27694 |
atatgctcaagtccctgataagcagcagcgtggtcttattccttcaaactgttggatctggacacacagtttaactactcttaaagaagagtatactagt |
27595 |
T |
 |
| Q |
119 |
tgggatgatgatcgtagactcattatcctagttgataaattagacataggtatgcatatgatgattaaattagagacatatttctctcttcnnnnnnnnn |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27594 |
tgggatgatgatcgtagactcattatcctagttgataaattagacataggtatgcatatgatgattaaattagagacatatttctctcttcttctttttt |
27495 |
T |
 |
| Q |
219 |
natataaaattagaaacaaattcatgattctgaagattccttttattcatttttgtagaaccaactccaagaacttgtgagccct |
303 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27494 |
tatataaaattagaaacaaattcatgattctgaaaattccttttattcatttttgtagaaccaactccaagaacttgtgagccct |
27410 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0280 (Bit Score: 101; Significance: 5e-50; HSPs: 2)
Name: scaffold0280
Description:
Target: scaffold0280; HSP #1
Raw Score: 101; E-Value: 5e-50
Query Start/End: Original strand, 60 - 192
Target Start/End: Complemental strand, 2617 - 2485
Alignment:
| Q |
60 |
cttcaaactgttggatctggacacaaagtttaactactcttaaagaagagtatactagttgggatgatgatcgtagactcattatcctagttgataaatt |
159 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||| ||||||||||||||| |
|
|
| T |
2617 |
cttcaaattgttggatctggacacaaagtttaactactcttaaagaagagtatactaattgggattatgatcgtagactcattgtcctagttgataaatc |
2518 |
T |
 |
| Q |
160 |
agacataggtatgcatatgatgattaaattaga |
192 |
Q |
| |
|
||| ||||||||||| |||||||||||||||| |
|
|
| T |
2517 |
agaggtaggtatgcatgtgatgattaaattaga |
2485 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0280; HSP #2
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 249 - 301
Target Start/End: Complemental strand, 2307 - 2255
Alignment:
| Q |
249 |
tgaagattccttttattcatttttgtagaaccaactccaagaacttgtgagcc |
301 |
Q |
| |
|
||||||||||||||||| || |||| || |||||||||||||||||||||||| |
|
|
| T |
2307 |
tgaagattccttttattgatatttgcagcaccaactccaagaacttgtgagcc |
2255 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University