View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2602_high_34 (Length: 268)
Name: NF2602_high_34
Description: NF2602
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2602_high_34 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 19 - 268
Target Start/End: Original strand, 28767696 - 28767945
Alignment:
| Q |
19 |
aaaagcccttgctttttgctcaaactgctgctatattagaggtatttggttctaaaagttctgatttttatcannnnnnnagacacccttttgattatta |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||| |
|
|
| T |
28767696 |
aaaagcccttgctttttgctcaaactgctgctatattagaggtatttggttctaaaagttttgatttttatcatttttggagacacccttttgattatta |
28767795 |
T |
 |
| Q |
119 |
tcacttttt-gagatacccttttgggaatttatctaaaatttcttcattttgtgttttttgggtatggcgttgtattgcatggtgtgatagattcttcat |
217 |
Q |
| |
|
||||||||| |||||||| ||||||||||||| ||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28767796 |
tcacttttttgagataccgttttgggaatttaactaaattttcttcattttgt-ttttttgggtatggcgttgtattgcatggtgtgatagattcttcat |
28767894 |
T |
 |
| Q |
218 |
ggtttagttggtgagtaatccattgattaaatgcttaatgtagatttaatt |
268 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28767895 |
ggtttagttggtgagtaatccattgattaaatgcttaatgtagatttaatt |
28767945 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University