View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2602_high_36 (Length: 258)
Name: NF2602_high_36
Description: NF2602
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2602_high_36 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 18 - 250
Target Start/End: Original strand, 224347 - 224577
Alignment:
| Q |
18 |
caaatgagcaaaagcattccattaaagcctaacaatgccatagttttggtgaatgtaaattgtaaaatatcaaacacgatcaagttgtaacacaactggc |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
224347 |
caaatgagcaaaagcattccattaaagcctaacaatgccatagtt--ggtgaatgtaaattgtaaaatatcaaacaagatcaagttgtaacacaactggc |
224444 |
T |
|
| Q |
118 |
gatgatttcttaatcaactcaaccttgcatttatcaccgtttgacaaattgttgtccgttgcaaatttaatgaatcctttccccaatcgcagtcctgaac |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
224445 |
gatgatttcttaatcaactcaaccttgcatttatcaccgtttgacaaattgttgtacgttgcaaatttaatgaatcctttccccaatcgcagtcctgaac |
224544 |
T |
|
| Q |
218 |
gacctaaacgtgtacaacaaacatccctttgct |
250 |
Q |
| |
|
||||||||||||||||||||||||||| ||||| |
|
|
| T |
224545 |
gacctaaacgtgtacaacaaacatcccattgct |
224577 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University