View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2602_high_40 (Length: 250)
Name: NF2602_high_40
Description: NF2602
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2602_high_40 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 149; Significance: 8e-79; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 149; E-Value: 8e-79
Query Start/End: Original strand, 1 - 240
Target Start/End: Complemental strand, 609502 - 609281
Alignment:
| Q |
1 |
tgaagtgaaaatggagaggtatgagaggggaagtagaagaaggagatgcaaagaaggtaaacatgaaaacaatgaaaggttgggaaattggggtgaacct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
609502 |
tgaagtgaaaatggagaggtatgagaggggaagtagaagaaggagatgcaaagaaggtaaacatgaaaacaatgaaaggttgggaaattggggtgaacct |
609403 |
T |
 |
| Q |
101 |
ctttggcttgcattggcaacttcttgaaaactctcatttggatctttgtctctctatctattatttaacaatgatcatgtaaaacaannnnnnnnagaat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||| |
|
|
| T |
609402 |
ctttggcttgcattggcaacttcttgaaaactctcatttg------------------aattatttaacaatgatcatgtaaaacaattttttttagaat |
609321 |
T |
 |
| Q |
201 |
ttttaggtatctgttctttttcttctgaatatcccctttg |
240 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
609320 |
ttttaggtatctgttctttttcttctgaatatcccttttg |
609281 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University