View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2602_low_25 (Length: 333)
Name: NF2602_low_25
Description: NF2602
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2602_low_25 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 178; Significance: 6e-96; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 178; E-Value: 6e-96
Query Start/End: Original strand, 117 - 327
Target Start/End: Original strand, 34539548 - 34539758
Alignment:
| Q |
117 |
gtagcttaagccaaattacttgtttaacataataacctttccatatcttatcttatctaccctaaacctactaatgaaattgatcttaaactnnnnnnnt |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
34539548 |
gtagcttaagccaaattacttgtttaacataataacctttccatatcttatcttatctaccctaaacctactaatgaaattgatcttaaactaaaaaaat |
34539647 |
T |
 |
| Q |
217 |
tggcttgattagtgcaaataatttgggaaaagaaaggaataacgtataaggtggtgtttcctaccttcatacacgactttacttctttccctttccaatc |
316 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34539648 |
tggcttgattagtgcaaataatttggggaaagaaaggaataacgtataagatggtgtttcctaccttcatacacgactttacttctttccctttccaatc |
34539747 |
T |
 |
| Q |
317 |
ttctctgctcc |
327 |
Q |
| |
|
|||||| |||| |
|
|
| T |
34539748 |
ttctctactcc |
34539758 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 18 - 66
Target Start/End: Original strand, 34539443 - 34539491
Alignment:
| Q |
18 |
aaacatgcatcattacaaattgcaaataggatctaatttgtcgtacttt |
66 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34539443 |
aaacatgcatcattacaaattgcaaataggatctaatttgtcgtacttt |
34539491 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University