View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2602_low_28 (Length: 316)
Name: NF2602_low_28
Description: NF2602
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2602_low_28 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 284; Significance: 1e-159; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 284; E-Value: 1e-159
Query Start/End: Original strand, 17 - 316
Target Start/End: Complemental strand, 47645296 - 47644997
Alignment:
| Q |
17 |
aagtattgcctgatgcaaaagtgaacatttcatcaacagttccaccccatggagcagaaagtgctataaaatatttaatgaatttcttgcgccaagaaga |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
47645296 |
aagtattgcctgatgcaaaagtgaacatttcatcaacagttccaccccatggagcagaaagtgctataaaatgtttaatgaatttcttgcgccaagaaga |
47645197 |
T |
 |
| Q |
117 |
ggggtttcgattaaggagttcgaggacaaataaacctcccaagctgtgcgagacaagtatcaccggcttccctccattggaattgcttgctttttctatc |
216 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47645196 |
ggggttccgattaaggagttcgaggacaaataaacctcccaagctgtgtgagacaagtatcaccggcttccctccattggaattgcttgctttttctatc |
47645097 |
T |
 |
| Q |
217 |
aaattctttaggtcgtttaggaatttggaaccaacttgagatgggtgacctggtgctgctagaccatatcgaaaatcatagggagctccaaacagattct |
316 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47645096 |
aaattctttaggtcgtttaggaatttggaaccaacttgagatgggtgacttggtgctgctagaccatatcgaaaatcatagggagctccaaacagattct |
47644997 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 125; Significance: 2e-64; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 121 - 280
Target Start/End: Complemental strand, 31641890 - 31641730
Alignment:
| Q |
121 |
tttcgattaa-ggagttcgaggacaaataaacctcccaagctgtgcgagacaagtatcaccggcttccctccattggaattgcttgctttttctatcaaa |
219 |
Q |
| |
|
|||||||||| ||||||| ||||||||||||||||| || ||||| ||||||||||| | ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31641890 |
tttcgattaaaggagttcaaggacaaataaacctcctaatctgtgtgagacaagtattagtggcttccctccattggaattgcttgctttttctatcaaa |
31641791 |
T |
 |
| Q |
220 |
ttctttaggtcgtttaggaatttggaaccaacttgagatgggtgacctggtgctgctagac |
280 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31641790 |
ttctttaggtcgtttaggaatttggaaccaacttgagatgggtgacctggtgctgctagac |
31641730 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University