View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2602_low_29 (Length: 308)
Name: NF2602_low_29
Description: NF2602
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2602_low_29 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 60; Significance: 1e-25; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 18 - 209
Target Start/End: Original strand, 42803866 - 42804077
Alignment:
| Q |
18 |
atatatgtgtcttggtgtgggtattaaaaaggtggaggttgagacgacataaaaggagaaatcgt------------------gtaaaatttgagaaagg |
99 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||| |
|
|
| T |
42803866 |
atatatgtgtcttggtgtgggaattaaaaaggtggaggttgagacgaca-gaaaggagaaatcgtgtaaataggagaatttgagtaaaatttgagaaagg |
42803964 |
T |
 |
| Q |
100 |
aggaaggtagttttatatatgcagtct--atggtacacatatgacactattannnnnnnnnnnnnnnnnaaaaggaacactatgtatta-tttttaagag |
196 |
Q |
| |
|
|||| |||||||||||||||||||||| |||||||||||||||||||| || |||||||||||||||||||| |||||||||| |
|
|
| T |
42803965 |
aggacggtagttttatatatgcagtctaaatggtacacatatgacactaatatttttttattcttttttaaaaggaacactatgtattattttttaagag |
42804064 |
T |
 |
| Q |
197 |
aaatgttattaga |
209 |
Q |
| |
|
||||||||||||| |
|
|
| T |
42804065 |
aaatgttattaga |
42804077 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 205 - 263
Target Start/End: Original strand, 42807111 - 42807170
Alignment:
| Q |
205 |
ttagaacaattatttt-ttggcaacttttgaaacaaccttctatcttataattatatgtg |
263 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42807111 |
ttagaacaattatttttttggcaacttttgaaacaaccttctatcttataattatatgtg |
42807170 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 191 - 241
Target Start/End: Complemental strand, 35883681 - 35883631
Alignment:
| Q |
191 |
taagagaaatgttattagaacaattattttttggcaacttttgaaacaacc |
241 |
Q |
| |
|
||||||||||| |||| | |||||||||||||| ||||||||||||||||| |
|
|
| T |
35883681 |
taagagaaatgatatttgtacaattattttttgacaacttttgaaacaacc |
35883631 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 192 - 245
Target Start/End: Complemental strand, 30423668 - 30423615
Alignment:
| Q |
192 |
aagagaaatgttattagaacaattattttttggcaacttttgaaacaaccttct |
245 |
Q |
| |
|
|||||||||| |||| |||||||||||||||| || |||||| |||||| |||| |
|
|
| T |
30423668 |
aagagaaatgatatttgaacaattattttttgacagcttttgtaacaactttct |
30423615 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University