View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2602_low_46 (Length: 235)
Name: NF2602_low_46
Description: NF2602
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2602_low_46 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 19 - 219
Target Start/End: Complemental strand, 33804876 - 33804676
Alignment:
| Q |
19 |
ctaatcccaccgtgtaatcatcttctaggatggatatagagaccttatcccctttgatcaccgattgtggtagttgtgatgttggtatatcgcaaacgtt |
118 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33804876 |
ctaatcccaccgtgtaatcatcttctgggatggatatagagaccttatcccctttgatcaccgattgtggtagttgtgatgttggtatatcgcaaacgtt |
33804777 |
T |
|
| Q |
119 |
gcttatggtttgtgctaaggttttcttaggtttggggtcggtttctgggcaatcaggctttggtgttggtttcaaggggtcttgatataggcaaggctat |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
33804776 |
gcttatggtttgtgctaaggttttcttaggtttggggtcggtttctgggcaatcaggctttggtgttggtttcagggggtcttgatataggcaaggctat |
33804677 |
T |
|
| Q |
219 |
g |
219 |
Q |
| |
|
| |
|
|
| T |
33804676 |
g |
33804676 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University