View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2603_high_24 (Length: 239)
Name: NF2603_high_24
Description: NF2603
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2603_high_24 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 16 - 226
Target Start/End: Complemental strand, 4164743 - 4164533
Alignment:
| Q |
16 |
aagacaaactttttcaataggttgattgttcaccaccacccatggcacaaaagaatgaggtggatctagttttgctgtttcatcaatatatttttgtcca |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4164743 |
aagacaaactttttcaataggttgattgttcaccaccacccatggcacaaaagaatgaggtggatctagttttgctgtttcatcaatatatttttgtcca |
4164644 |
T |
 |
| Q |
116 |
aactgcacacaaaattcaaatttattattaaggacattttaacaatctcacacaaggtatcatataaactataaccttggatgctagaagatctatctag |
215 |
Q |
| |
|
||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4164643 |
aactgtacacaaaattcaaatttattgttaaggacattttaacaatctcacacaaggtatcatataaactataaccttggatgctagaagatctatctag |
4164544 |
T |
 |
| Q |
216 |
cacaagatatt |
226 |
Q |
| |
|
||||||||||| |
|
|
| T |
4164543 |
cacaagatatt |
4164533 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University