View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2603_high_27 (Length: 215)
Name: NF2603_high_27
Description: NF2603
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2603_high_27 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 181; Significance: 6e-98; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 1 - 197
Target Start/End: Original strand, 22339189 - 22339385
Alignment:
| Q |
1 |
cattcagaggttaggcttgctaatgagtctcatttgttattgtgtagcaatgatatgttgtgggagttatcattacccgttggagttgaccgtgattatg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
22339189 |
cattcagaggttaggcttgctaatgagtctcatttgttattgtgtaacaatgatatgttgtgggagttatcattacccgttggagttaaccgtgattatg |
22339288 |
T |
 |
| Q |
101 |
agtattgtaatccaacggtgggagataatgttttgggattggaaaatattagaagacttgggtggtatgtgttggtgactgattgtgatggtgatcc |
197 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
22339289 |
agtattgtaatccaacggtgggagatagtgttttgggattggaaaatattagaagacttgggtggtgtgtgttggtgactgattgtgatggtgatcc |
22339385 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 37; Significance: 0.000000000005; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 79 - 119
Target Start/End: Complemental strand, 46138630 - 46138590
Alignment:
| Q |
79 |
gttggagttgaccgtgattatgagtattgtaatccaacggt |
119 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
46138630 |
gttggagttgaccgtgatcatgagtattgtaatccaacggt |
46138590 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 82 - 120
Target Start/End: Complemental strand, 46140542 - 46140504
Alignment:
| Q |
82 |
ggagttgaccgtgattatgagtattgtaatccaacggtg |
120 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
46140542 |
ggagttgatcgtgattatgagtattgtaatccaacggtg |
46140504 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University