View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2603_high_29 (Length: 210)
Name: NF2603_high_29
Description: NF2603
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2603_high_29 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 47; Significance: 5e-18; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 1 - 59
Target Start/End: Complemental strand, 43601397 - 43601339
Alignment:
| Q |
1 |
ttatgtcatatttatattcctttgtttcttcatccactgtttacttgttctttgccaac |
59 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||| ||||||||| |||||||||||| |
|
|
| T |
43601397 |
ttatgtcatatttatattcctttgtttcttcgtccattgtttacttattctttgccaac |
43601339 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 154 - 199
Target Start/End: Complemental strand, 43601244 - 43601199
Alignment:
| Q |
154 |
agatgtatctacagagaagaagaaagatacgcatatagttcatttc |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43601244 |
agatgtatctacagagaagaagaaagatacgcatatagttcatttc |
43601199 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University