View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2603_low_12 (Length: 384)
Name: NF2603_low_12
Description: NF2603
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2603_low_12 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 308; Significance: 1e-173; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 308; E-Value: 1e-173
Query Start/End: Original strand, 1 - 363
Target Start/End: Original strand, 15376925 - 15377294
Alignment:
| Q |
1 |
gctatccactccggcggcgacttctccgatcaacctccggcgatttctccgatcatcccaaaaccatgacaacaacagaatgaatct-------tctcga |
93 |
Q |
| |
|
||||||| |||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||| |||| | |||||||||| || ||| |
|
|
| T |
15376925 |
gctatcctctccggcggcaacttctccgatcaacctccggcgacttctccgatcatcccaaaaccatgataacaccggaatgaatctcatccactcccga |
15377024 |
T |
|
| Q |
94 |
tgtcgatttcatactccaactttttcaccgactccgacctcttatgcggcgaggaaacctccagcatcttatcgtcagattcgccgacggaatccttctc |
193 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15377025 |
tgtcgatttcatactccaacttcttcaccgactccgacctcttatgcggcgaggaaacctccagcatcttatcgtcagattcgccgacggaatccttctc |
15377124 |
T |
|
| Q |
194 |
cgatggtgaatcttatccgccgccggaggatgagttcatcgccggattaatcgaagacgaacgtaaattcgtcatcggattcgattatttcgtgaagatg |
293 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15377125 |
cgatggtgaatcttatccgccgccggaggatgagttcatcgccggattaatcgaagacgaaggtaaattcgtcatcggattcgattatttcgtgaagatg |
15377224 |
T |
|
| Q |
294 |
aaatctagctcgttcgattccgatgctagagatgaatccattcgatggatcctaaaggtaaaatctcgat |
363 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15377225 |
aaatctagctcgttcgattccgatgctagagatgaatccattcgatggatcctaaaggtaaaatctcgat |
15377294 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University