View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2603_low_35 (Length: 204)
Name: NF2603_low_35
Description: NF2603
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2603_low_35 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 1 - 204
Target Start/End: Complemental strand, 26609348 - 26609145
Alignment:
| Q |
1 |
tgtcaatgtttgtgtcgtttccgatgcctgtgcttcatttagagatgttataaaacgtttaattttttagcttacctaataagttgtggtggcagtaatg |
100 |
Q |
| |
|
||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
26609348 |
tgtcaatgtttatgtcgtttccgatgcatgtgcttcatttagagatgttataaaacgtttaattttttagcttaccttataagttgtggtggcagtaatg |
26609249 |
T |
 |
| Q |
101 |
gttatagtcacattgccatctttgacatctctgataaatgtgattgatgaagccacaatcgcagttgcattgcagtgtcgacaatatctaaaactattat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26609248 |
gttatagtcacattgccatctttgacatctctgataaatgtgattgatgaagccacaatcgcagttgcattgcagtgtcgacaatatctaaaactattat |
26609149 |
T |
 |
| Q |
201 |
agat |
204 |
Q |
| |
|
|||| |
|
|
| T |
26609148 |
agat |
26609145 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University