View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2604_high_35 (Length: 294)
Name: NF2604_high_35
Description: NF2604
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2604_high_35 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 169; Significance: 1e-90; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 169; E-Value: 1e-90
Query Start/End: Original strand, 1 - 251
Target Start/End: Complemental strand, 43255477 - 43255239
Alignment:
| Q |
1 |
acatttacaagaactagaataattcagcatctttgtgtgttaacttctttgttgcaccccttccttaatggaagttttccctttctcatgaaaggttcct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43255477 |
acatttacaagaactagaataattcagcatctttgtgtgttaacttctttgttgcaccccttccttaatggaagttttccctttctcatgaaaggttcct |
43255378 |
T |
|
| Q |
101 |
tttgttacttgcttgcccatcccaatccaaattccatcctccttacc----atgtcaccaccatcacatcttttgctgccaccgatccagatccacaaaa |
196 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||| | || | |
|
|
| T |
43255377 |
tttgttacttgcttgcccctcccaatccaaattccatcctccttaccatatatgtcaccaccatcacatcttttgcttgcccc----------------a |
43255294 |
T |
|
| Q |
197 |
cctcttcatttacatgatctttctcttttgctcgaaacacaatctctgtctcgac |
251 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43255293 |
cctcttcatttacatgatctttctcttttgctcgaaacacaatctctgtctcgac |
43255239 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 1 - 56
Target Start/End: Complemental strand, 43258743 - 43258688
Alignment:
| Q |
1 |
acatttacaagaactagaataattcagcatctttgtgtgttaacttctttgttgca |
56 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
43258743 |
acatttacaagaactagaaatattcagcatctttgtgtgttaacttctttgttgca |
43258688 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University