View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2604_high_38 (Length: 289)
Name: NF2604_high_38
Description: NF2604
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2604_high_38 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 269; Significance: 1e-150; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 269; E-Value: 1e-150
Query Start/End: Original strand, 1 - 282
Target Start/End: Complemental strand, 48487103 - 48486820
Alignment:
| Q |
1 |
tgttcccgatgcaatttgtgttatgtttttcggttattcgaaaaatggaaagcacagggtaagctcttctcaacacacctttatgtaaaggtttgagttg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48487103 |
tgttcccgatgcaatttgtgttatgtttttcggttattcgaaaaatggaaagcacagggtaagctcttctcaacacacctttatgtaaaggtttgagttg |
48487004 |
T |
 |
| Q |
101 |
ttgttattgttgaaatctaatgaatttgtgatgggcacttggcaggactatgcatgggcgaagcaggggatggtattccccttcttggaattcatggata |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48487003 |
ttgttattgttgaaatctaatgaatttgtgatgggcacttggcaggactatgcatgggcgaagcaggggatggtattccccttcttggaattcatggata |
48486904 |
T |
 |
| Q |
201 |
ggtttgtgtttgtg--tgtgattttggttgttgttctgcctgcaagaatatttggcttgtattcgctcatattaagaataatct |
282 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
48486903 |
ggtttgtgtttgtgtgtgtgattttggttgttgttctgcctgcaagaatatttggcttgtactcgctcatattaagaataatct |
48486820 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 1 - 50
Target Start/End: Original strand, 10032676 - 10032725
Alignment:
| Q |
1 |
tgttcccgatgcaatttgtgttatgtttttcggttattcgaaaaatggaa |
50 |
Q |
| |
|
|||||| ||| || ||||||| |||||||||||||||||||||||||||| |
|
|
| T |
10032676 |
tgttccggatacactttgtgtgatgtttttcggttattcgaaaaatggaa |
10032725 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University