View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2604_high_39 (Length: 289)
Name: NF2604_high_39
Description: NF2604
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2604_high_39 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 245; Significance: 1e-136; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 245; E-Value: 1e-136
Query Start/End: Original strand, 2 - 280
Target Start/End: Original strand, 48115494 - 48115771
Alignment:
| Q |
2 |
cttgccacgatcaatattctctggtgtagctaaacaatgatttaaaccgacagacaatttttattttaatatactcccaccacgtgggagcttcccatgc |
101 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48115494 |
cttgccacgatcaatattctctggtgtagctaaacaatgatttaaaccgacagacaatttttattttaatatactcccaccacgtgggagcttcccatgc |
48115593 |
T |
|
| Q |
102 |
catatcagggaacattgtagacatattgtttgtttaaagaatcaataattcattgctggatgcaaaatgtctaaccatttcgaatactatatgttggtaa |
201 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48115594 |
catatcagggaacattgtagacatattgtttgtttaaagaatcaataattcattgttggatgcaaaatgtctaaccatttcgaatactatatgttggtaa |
48115693 |
T |
|
| Q |
202 |
atttcaattcatgttcagnnnnnnnattaattaacaaacttaatcaacctgaaagcattcatgttgtctgatttagtat |
280 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
48115694 |
atttcaattcatgttcag-ttttttattaattaacaaacttaatcaacgtgaaagcattcatgttgtctgatttagtat |
48115771 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University