View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2604_high_44 (Length: 253)
Name: NF2604_high_44
Description: NF2604
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2604_high_44 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 244; Significance: 1e-135; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 244; E-Value: 1e-135
Query Start/End: Original strand, 10 - 253
Target Start/End: Original strand, 48486587 - 48486830
Alignment:
| Q |
10 |
catcatcagtcatgaatcatgatcatacacaacacgaagtggaaaaattaaaatcacctggccttggcagtgatattcctgttcagcacaggaagtcgca |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48486587 |
catcatcagtcatgaatcatgatcatacacaacacgaagtggaaaaattaaaatcacctggccttggcagtgatattcctgttcagcacaggaagtcgca |
48486686 |
T |
 |
| Q |
110 |
ccctccacaatttgcttagctctataatgtggatccagaatgccattatctgccaacattgcctcctccattgcctcgtgaaagtcacttcctttggtct |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48486687 |
ccctccacaatttgcttagctctataatgtggatccagaatgccattatctgccaacattgcctcctccattgcctcgtgaaagtcacttcctttggtct |
48486786 |
T |
 |
| Q |
210 |
tgtacaatcgggtctgcccctggaatctgaacaagattattctt |
253 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48486787 |
tgtacaatcgggtctgcccctggaatctgaacaagattattctt |
48486830 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University