View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2604_high_52 (Length: 237)
Name: NF2604_high_52
Description: NF2604
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2604_high_52 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 1 - 226
Target Start/End: Complemental strand, 48486541 - 48486314
Alignment:
| Q |
1 |
ttgtgtgtgaacttgtaatttagatgacataggctacatgcattagtcggcattcttcttagtaggaagggttaagggctatatatgctctagcatctga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48486541 |
ttgtgtgtgaacttgtaatttagatgacataggctacatgcattagtcggcattcttcttagtaggaagggttaagggctatatatgctctagcatctga |
48486442 |
T |
|
| Q |
101 |
tttggttatagcatacttcttggtctttgatgtcataaatcatgtttgaacatgactcatgaattgaaatatataac--aaattaatcacctatgaccac |
198 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
48486441 |
tttggttatagcatacttcttggtctttgatgtcataaatcatgtttgagcatgactcatgaattgaaatatataacaaaaattaatcacctatgaccac |
48486342 |
T |
|
| Q |
199 |
tgaatgaaacacaagagtttaaatgatg |
226 |
Q |
| |
|
||||||||||| |||||||||||||||| |
|
|
| T |
48486341 |
tgaatgaaacataagagtttaaatgatg |
48486314 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University