View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2604_high_59 (Length: 213)

Name: NF2604_high_59
Description: NF2604
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2604_high_59
NF2604_high_59
[»] chr7 (1 HSPs)
chr7 (23-194)||(22597742-22597919)


Alignment Details
Target: chr7 (Bit Score: 127; Significance: 9e-66; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 127; E-Value: 9e-66
Query Start/End: Original strand, 23 - 194
Target Start/End: Complemental strand, 22597919 - 22597742
Alignment:
23 tcgccatctcttacgctttttctcatcatcaccaccattgtcgccactgtcccaatgctcatatctaactaccatgaccaccacaacttttgtcatctct 122  Q
    |||||||||||||||||||||||  || ||||||||||||||||||| |||||||| |||||||||||| ||||||||||||||||||||||||||||||    
22597919 tcgccatctcttacgctttttcttgtcgtcaccaccattgtcgccaccgtcccaatcctcatatctaaccaccatgaccaccacaacttttgtcatctct 22597820  T
123 caccctctcgtctcattgtctccaccaccactgcca------tcctcatcccctctcatccgcatatgttctctttgc 194  Q
    |||||||||||||| |||||||||||||||||||||      ||||||||||||||||||||||||||||||||||||    
22597819 caccctctcgtctcgttgtctccaccaccactgccactgccgtcctcatcccctctcatccgcatatgttctctttgc 22597742  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University