View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2604_low_27 (Length: 358)
Name: NF2604_low_27
Description: NF2604
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2604_low_27 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 64; Significance: 6e-28; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 64; E-Value: 6e-28
Query Start/End: Original strand, 13 - 84
Target Start/End: Original strand, 24656049 - 24656120
Alignment:
| Q |
13 |
gaatatcattaacgattaaaccctcaatttagatcactcttctatctagtctttaaacaataaacacacaat |
84 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
24656049 |
gaatatcattaacgagtaaaccctcaatttagatcactcttctatctagtctttaaacaatgaacacacaat |
24656120 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 13 - 88
Target Start/End: Complemental strand, 29415286 - 29415210
Alignment:
| Q |
13 |
gaatatcattaacgattaaaccctcaatttagatcactcttctatctagtc-tttaaacaataaacacacaatgttt |
88 |
Q |
| |
|
||||||||||||||| ||||||||||||||||| | ||||| | ||||||| |||||| ||| |||||||||||||| |
|
|
| T |
29415286 |
gaatatcattaacgagtaaaccctcaatttagacccctcttttgtctagtcttttaaataatgaacacacaatgttt |
29415210 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 159 - 197
Target Start/End: Original strand, 13992461 - 13992499
Alignment:
| Q |
159 |
tacaacttgtatttaaatactaccgttcaggttacaata |
197 |
Q |
| |
|
|||||||||| ||||||||||||||||||| |||||||| |
|
|
| T |
13992461 |
tacaacttgtgtttaaatactaccgttcagtttacaata |
13992499 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University