View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2604_low_33 (Length: 318)
Name: NF2604_low_33
Description: NF2604
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2604_low_33 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 268; Significance: 1e-149; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 268; E-Value: 1e-149
Query Start/End: Original strand, 20 - 307
Target Start/End: Original strand, 31009085 - 31009372
Alignment:
| Q |
20 |
tatttacctcaatttggctccatctgcattttgttgttgcttcttctgcaatcaacaaccaatctccatctgcaggagaagcacacaacacaaaaatggg |
119 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||| ||||||||| |||||||||||||||||||||||| |
|
|
| T |
31009085 |
tatttacctcaatttggctccatctgaattttgttgttgcttcttctgcaatcaacaatcaatctacatctgcagaagaagcacacaacacaaaaatggg |
31009184 |
T |
|
| Q |
120 |
gtatgtagaaacaacctcatcacaactacacacccctcttctttctgaccaaccccctctgtcctcaaaatccaaaacctttgcaaacctcttcattgca |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31009185 |
gtatgtagaaacaacctcatcacaactacacacccctcttctttctgaccaaccccctctgtcctcaaaatccaaaacctttgcaaacctcttcattgca |
31009284 |
T |
|
| Q |
220 |
attgtaggtgcaggtgttcttggtctcccttatactttcacgaaaacaggttggattatggggttgcttatgcttttctctgtttcat |
307 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
31009285 |
attgtaggtgcaggtgttcttggtctcccttatactttcacgaaaacaggttggatcatggggttgcttatgcttttctctgtttcat |
31009372 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University