View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2604_low_35 (Length: 308)
Name: NF2604_low_35
Description: NF2604
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2604_low_35 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 194; Significance: 1e-105; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 18 - 215
Target Start/End: Complemental strand, 51413056 - 51412859
Alignment:
| Q |
18 |
attattggcaaagactttggaatttaaaggaaagaaaaagctaggtaggataaaggcagagaaagagaacgttggtttaatgttgctgttttggatattg |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51413056 |
attattggcaaagactttggaatttaaaggaaagaaaaagctaggtaggataagggcagagaaagagaacgttggtttaatgttgctgttttggatattg |
51412957 |
T |
|
| Q |
118 |
ataggtggtagtgaactataatcatgacagtttcattgtgcttgtctttctttttccttactttccttgttattggaacttcttttgctatcattatg |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51412956 |
ataggtggtagtgaactataatcatgacagtttcattgtgcttgtctttctttttccttactttccttgttattggaacttcttttgctatcattatg |
51412859 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 125 - 203
Target Start/End: Complemental strand, 51417987 - 51417909
Alignment:
| Q |
125 |
gtagtgaactataatcatgacagtttcattgtgcttgtctttctttttccttactttccttgttattggaacttctttt |
203 |
Q |
| |
|
|||||||| ||||||||||||| ||| |||||| | ||| |||||||||| | ||||| ||||||||||||| ||||| |
|
|
| T |
51417987 |
gtagtgaagtataatcatgacacttttattgtgatcgtccttctttttccattctttctatgttattggaactcctttt |
51417909 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University