View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2604_low_40 (Length: 292)
Name: NF2604_low_40
Description: NF2604
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2604_low_40 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 191; Significance: 1e-104; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 1 - 199
Target Start/End: Complemental strand, 48487103 - 48486905
Alignment:
| Q |
1 |
tgttcccgatgcaatttgtgttatgtttttcggttattcgaaaaatggaaagcacagggtaagctcttctcaacacacctttatgtaaaggtttgagttg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48487103 |
tgttcccgatgcaatttgtgttatgtttttcggttattcgaaaaatggaaagcacagggtaagctcttctcaacacacctttatgtaaaggtttgagttg |
48487004 |
T |
 |
| Q |
101 |
ttgttattgttgaaatctaatgaatttgtgatgggcacttggcaggactatgcatgggcgaagcaggggatggtattccccttcttggattttatggat |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||| |
|
|
| T |
48487003 |
ttgttattgttgaaatctaatgaatttgtgatgggcacttggcaggactatgcatgggcgaagcaggggatggtattccccttcttggaattcatggat |
48486905 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 101; E-Value: 4e-50
Query Start/End: Original strand, 185 - 285
Target Start/End: Original strand, 48470243 - 48470343
Alignment:
| Q |
185 |
ttggattttatggattggtatttatatttgtgctgtgttggtgtttggtttttctaggatggggaagagggcattgaatgaaagtgatgatgattctgat |
284 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48470243 |
ttggattttatggattggtatttatatttgtgctgtgttggtgtttggtttttctaggatggggaagagggcattgaatgaaagtgatgatgattctgat |
48470342 |
T |
 |
| Q |
285 |
g |
285 |
Q |
| |
|
| |
|
|
| T |
48470343 |
g |
48470343 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 1 - 50
Target Start/End: Original strand, 10032676 - 10032725
Alignment:
| Q |
1 |
tgttcccgatgcaatttgtgttatgtttttcggttattcgaaaaatggaa |
50 |
Q |
| |
|
|||||| ||| || ||||||| |||||||||||||||||||||||||||| |
|
|
| T |
10032676 |
tgttccggatacactttgtgtgatgtttttcggttattcgaaaaatggaa |
10032725 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University