View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2604_low_48 (Length: 247)
Name: NF2604_low_48
Description: NF2604
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2604_low_48 |
 |  |
|
| [»] chr2 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 156; Significance: 5e-83; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 156; E-Value: 5e-83
Query Start/End: Original strand, 71 - 247
Target Start/End: Complemental strand, 8923206 - 8923034
Alignment:
| Q |
71 |
tagtgtgagaaagggaacaacattatcatacctctaagggaaaccaaaaagcaaaggcatgcatgccattaaaggagctaattaattatatcgaacgtgt |
170 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
8923206 |
tagtgtgagaaagggaacaacattatcatacctctaagggaaaccaaaaagcaaaggcatgcatgccattaaaggagctaatta----tatcgaacgtgt |
8923111 |
T |
 |
| Q |
171 |
acaagtaaaaagtgatgcttactccatttcacccgtctatggtgcaataatcaatatatcaactaattaagtgtctc |
247 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8923110 |
acaagtaaaaagtgatgcttacgccatttcacccgtctatggtgcaataatcaatatatcaactaattaagtgtctc |
8923034 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 15 - 48
Target Start/End: Complemental strand, 8923262 - 8923229
Alignment:
| Q |
15 |
aattaagacccataaaataacataagtattaccc |
48 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
8923262 |
aattaagacccataaaataacataagtattaccc |
8923229 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University