View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2604_low_49 (Length: 247)
Name: NF2604_low_49
Description: NF2604
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2604_low_49 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 18 - 234
Target Start/End: Complemental strand, 38179202 - 38178986
Alignment:
| Q |
18 |
agaaactagttcagccatttccgcaaacaccttgttctccatctctccgagtctaccatgttccgcaggtaaatgcaactttacgctttctgagttcgtg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38179202 |
agaaactagttcagccatttccgcaaacaccttgttctccatctctccgagtataccatgttccgcaggtaaatgcaactttacgctttctgagttcgtg |
38179103 |
T |
 |
| Q |
118 |
atgccgattaatcgaatcgtgtctactcttttgattttcactgtttgcgatcgaattcttgcgtttgtttcatcattatgattatttactgcaggtccat |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38179102 |
atgccgattaatcgaatcgtgtctactcttttgattttcactgtttgcgatcgaattcttgcgtttgtttcatcattatgattatttactgcaggtccat |
38179003 |
T |
 |
| Q |
218 |
tttgcaattttcatctc |
234 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
38179002 |
tttgcaattttcatctc |
38178986 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University