View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2604_low_51 (Length: 241)
Name: NF2604_low_51
Description: NF2604
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2604_low_51 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 18 - 226
Target Start/End: Original strand, 34429589 - 34429794
Alignment:
| Q |
18 |
aagtaaacgtataaaatcggaatacaaagaaggcgacgatgatgatgatgaggaggatggtatgggtgttgagaatgcaaagcaacaggaaaagaagaat |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34429589 |
aagtaaacgtataaaatcggaatacaaagaag---acgatgatgatgatgagggggatggtatgggtgttgagaatgcaaagcaacaggaaaagaagaat |
34429685 |
T |
 |
| Q |
118 |
ggttgggaaaatgaatgcaaagtgttggaggaggctgtgttagcagcaagagatgatgcttctgatgagaatttggtgaagttgttgaaattgattcatg |
217 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34429686 |
ggttgggaaaatgaatgcgaagtgttggaggaggctgtgttagcagcaagagatgatgcttctgatgagaatttggtgaagttgttgaaattgattcatg |
34429785 |
T |
 |
| Q |
218 |
gttttgatt |
226 |
Q |
| |
|
||||||||| |
|
|
| T |
34429786 |
gttttgatt |
34429794 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University