View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2604_low_52 (Length: 241)
Name: NF2604_low_52
Description: NF2604
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2604_low_52 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 154; Significance: 8e-82; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 154; E-Value: 8e-82
Query Start/End: Original strand, 1 - 226
Target Start/End: Original strand, 28229594 - 28229817
Alignment:
| Q |
1 |
tccttttccgacgtcagacgtcgtagctttgccttcgtcgtcggatttagaatctcaattttgatatcgccgctgcatcatcgccattgttgagaatcaa |
100 |
Q |
| |
|
|||||||||||| || |||| ||| ||||||||| ||||| |||||||||| ||||||||| ||||||| ||||||||||||| ||| |||||||||||| |
|
|
| T |
28229594 |
tccttttccgacatcggacgccgttgctttgcctccgtcgccggatttagattctcaattt-gatatcgtcgctgcatcatcgtcatcgttgagaatcaa |
28229692 |
T |
 |
| Q |
101 |
ttcattaagcttttcaattgcaattgatgatacttaccatttggtgttcattgcttttgataatgtttttcatgctgctgtttatcagatattgcagaac |
200 |
Q |
| |
|
| |||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||| ||||| |
|
|
| T |
28229693 |
tgcattaagcttttcaattgcaattgatgataattaccatttgatgttcattgcttttgataatgtttttcatgctgctgtttatcagat-ttgtagaac |
28229791 |
T |
 |
| Q |
201 |
ttttgttctagagaagatacaatttt |
226 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
28229792 |
ttttgttctagagaagatacaatttt |
28229817 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 46; Significance: 2e-17; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 166 - 223
Target Start/End: Original strand, 30477437 - 30477494
Alignment:
| Q |
166 |
tttttcatgctgctgtttatcagatattgcagaacttttgttctagagaagatacaat |
223 |
Q |
| |
|
||||||||||| |||||||||| | ||||||||||||||||||||||||||||||||| |
|
|
| T |
30477437 |
tttttcatgcttctgtttatcatacattgcagaacttttgttctagagaagatacaat |
30477494 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University