View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2604_low_53 (Length: 240)
Name: NF2604_low_53
Description: NF2604
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2604_low_53 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 103; Significance: 2e-51; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 103; E-Value: 2e-51
Query Start/End: Original strand, 81 - 195
Target Start/End: Complemental strand, 10395973 - 10395859
Alignment:
| Q |
81 |
gggaacaggagaaatgtcttgaggtcttaggtgatgaagtggtattcaactcacttctataattgctcttggcccaacataatgatctaatcagtgatgc |
180 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
10395973 |
gggaacaggagaaatgtcttgaggtcttaggtgatgaagtggtattcaactcacttgtataattgctcttagcccaacataatgatctaatcagtgatgc |
10395874 |
T |
|
| Q |
181 |
tcaccttatcgatgg |
195 |
Q |
| |
|
||||||||| ||||| |
|
|
| T |
10395873 |
tcaccttatggatgg |
10395859 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 18 - 89
Target Start/End: Complemental strand, 10397299 - 10397228
Alignment:
| Q |
18 |
attgttcttagcgtaaagtgaggaccccccgcccatgtgtcccaactctggttagacttgatggggaacagg |
89 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10397299 |
attgttcttagcgtaaagtgaggaccccccacccatgtgtcccaactctggttagacttgatggggaacagg |
10397228 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University