View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2604_low_63 (Length: 213)
Name: NF2604_low_63
Description: NF2604
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2604_low_63 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 127; Significance: 9e-66; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 127; E-Value: 9e-66
Query Start/End: Original strand, 23 - 194
Target Start/End: Complemental strand, 22597919 - 22597742
Alignment:
| Q |
23 |
tcgccatctcttacgctttttctcatcatcaccaccattgtcgccactgtcccaatgctcatatctaactaccatgaccaccacaacttttgtcatctct |
122 |
Q |
| |
|
||||||||||||||||||||||| || ||||||||||||||||||| |||||||| |||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
22597919 |
tcgccatctcttacgctttttcttgtcgtcaccaccattgtcgccaccgtcccaatcctcatatctaaccaccatgaccaccacaacttttgtcatctct |
22597820 |
T |
|
| Q |
123 |
caccctctcgtctcattgtctccaccaccactgcca------tcctcatcccctctcatccgcatatgttctctttgc |
194 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
22597819 |
caccctctcgtctcgttgtctccaccaccactgccactgccgtcctcatcccctctcatccgcatatgttctctttgc |
22597742 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University