View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2604_low_64 (Length: 209)
Name: NF2604_low_64
Description: NF2604
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2604_low_64 |
 | |
|
| [»] scaffold0062 (2 HSPs) |
| | |
|
Alignment Details
Target: scaffold0062 (Bit Score: 145; Significance: 2e-76; HSPs: 2)
Name: scaffold0062
Description:
Target: scaffold0062; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 7 - 178
Target Start/End: Complemental strand, 4546 - 4374
Alignment:
| Q |
7 |
caaccgaagctcaaatgtaaa-catcctaaacacataaaatgttcactaagacttgaaccatcgggacatggaatatatgattgaattttaaaatctaag |
105 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
4546 |
caaccgaagctcaaatgtaaaacatcctaaacacataaaatgttcactaagactagaaccatcaagacatggaatatatgattgaattttaaaatctaag |
4447 |
T |
|
| Q |
106 |
tgaaacaaaatcttttgtttatctaaagtttaaacctcaatcaatacatacataataatgtgatgtgtctatc |
178 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
4446 |
tgaagcaaaatcttttgtttatctaaagtttaaacctcaatcagtacatacataataatgtgatgtgtctatc |
4374 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0062; HSP #2
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 133 - 178
Target Start/End: Complemental strand, 71234 - 71189
Alignment:
| Q |
133 |
gtttaaacctcaatcaatacatacataataatgtgatgtgtctatc |
178 |
Q |
| |
|
|||||||| ||||||| | |||||||| |||||||||||||||||| |
|
|
| T |
71234 |
gtttaaacatcaatcactgcatacatattaatgtgatgtgtctatc |
71189 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 30; Significance: 0.00000007; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 133 - 178
Target Start/End: Complemental strand, 15722677 - 15722632
Alignment:
| Q |
133 |
gtttaaacctcaatcaatacatacataataatgtgatgtgtctatc |
178 |
Q |
| |
|
|||||||| ||||||| | |||||||| |||||||||||||||||| |
|
|
| T |
15722677 |
gtttaaacatcaatcactgcatacatattaatgtgatgtgtctatc |
15722632 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University