View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2605_high_12 (Length: 539)
Name: NF2605_high_12
Description: NF2605
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2605_high_12 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 350; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 350; E-Value: 0
Query Start/End: Original strand, 19 - 416
Target Start/End: Original strand, 47523339 - 47523736
Alignment:
| Q |
19 |
atagaaaccattcagagtggatcgaggagcagagtggctgacctccaaagcggtatagaggatagtgaccaatatttaggacattcttaattaataatag |
118 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47523339 |
atagaaaccgttcagagtggatcgaggagcagagtggctgacctccaaagcggtatagaggatagtgaccaatatttaggacattcttaattaataatag |
47523438 |
T |
|
| Q |
119 |
aagtttatcttgattattttcaagtaattggattggatttttatttgtgttaaggtggtctgctgtttgaacaggaaatgaaaattgccttgctctttca |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47523439 |
aagtttatcttgattattttcaagtaattggattggatttttatttgtgttaaggtggtctggtgtttgaacaggaaatgaaaattgccttgctctttca |
47523538 |
T |
|
| Q |
219 |
atttgtccttcagttggtctaggggctttttgtattgattgtaatctagtttggattggatcatattggtgagtctgatctggggtggtttcattgcgct |
318 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||| |
|
|
| T |
47523539 |
atttgtccttcagttggtctaggggctttttgtattgattgtaatctagtttggattggatcatattggtgaatctgatctggggtggtttcattgtgct |
47523638 |
T |
|
| Q |
319 |
ccaannnnnnnncagttctgttggttttagtgtcggatggtgaagaatgtagccaatcacgtgccacggcacctcgaccgtgcttcgactttactatg |
416 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||| |
|
|
| T |
47523639 |
ccaattttgtttcagttctgttggttttagtgtcggatggtgaagaatgtagccaatcacgtgccacagcacctcgactgtgcttcgactttactatg |
47523736 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 29; Significance: 0.0000008; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 377 - 409
Target Start/End: Complemental strand, 29168590 - 29168558
Alignment:
| Q |
377 |
acgtgccacggcacctcgaccgtgcttcgactt |
409 |
Q |
| |
|
||||||||| ||||||||||||||||||||||| |
|
|
| T |
29168590 |
acgtgccacagcacctcgaccgtgcttcgactt |
29168558 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 29; Significance: 0.0000008; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 377 - 413
Target Start/End: Original strand, 9454650 - 9454686
Alignment:
| Q |
377 |
acgtgccacggcacctcgaccgtgcttcgactttact |
413 |
Q |
| |
|
||||||||| ||||||||||||||||| ||||||||| |
|
|
| T |
9454650 |
acgtgccacagcacctcgaccgtgctttgactttact |
9454686 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 29; Significance: 0.0000008; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 377 - 409
Target Start/End: Original strand, 26377360 - 26377392
Alignment:
| Q |
377 |
acgtgccacggcacctcgaccgtgcttcgactt |
409 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |
|
|
| T |
26377360 |
acgtgccacggcacctccaccgtgcttcgactt |
26377392 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University