View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2605_high_29 (Length: 359)
Name: NF2605_high_29
Description: NF2605
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2605_high_29 |
 |  |
|
| [»] scaffold0013 (1 HSPs) |
 |  |  |
|
| [»] scaffold0182 (1 HSPs) |
 |  |  |
|
| [»] scaffold0009 (1 HSPs) |
 |  |  |
|
| [»] scaffold0071 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr2 (Bit Score: 145; Significance: 3e-76; HSPs: 22)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 145; E-Value: 3e-76
Query Start/End: Original strand, 6 - 216
Target Start/End: Complemental strand, 37092376 - 37092181
Alignment:
| Q |
6 |
aggagcacagattgaatctgtcactaatgataacttgattgttagtgttttcaatagcttggatcaacctttccttatttcttggttagtttactctctc |
105 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37092376 |
aggaccacagattgaatctgtcactaatgataacttgattgttagtgttttcaatagcttggatcaacctttccttatttcttggttagtttactctctc |
37092277 |
T |
 |
| Q |
106 |
ttctaactttcttgtttagnnnnnnnnnnnnnaaagtatcatcttgccgtccatttgggtcccacaatgctcgagggattagtctccgcagttgcgcgcg |
205 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| || || |
|
|
| T |
37092276 |
ttctaactttcttgttt---------------aaagtatcatcttgccgtccatttgggtcccacagtgctcgagggattagtctccgcagttgtgcacg |
37092192 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 59; E-Value: 6e-25
Query Start/End: Original strand, 150 - 220
Target Start/End: Original strand, 25423833 - 25423903
Alignment:
| Q |
150 |
tgccgtccatttgggtcccacaatgctcgagggattagtctccgcagttgcgcgcggaggatacccgattt |
220 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||| |
|
|
| T |
25423833 |
tgccgcccatttgggtcccacaatgctcgagggattagtctcagcagttgcgcgtggaggatacccgattt |
25423903 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 150 - 220
Target Start/End: Original strand, 5394485 - 5394555
Alignment:
| Q |
150 |
tgccgtccatttgggtcccacaatgctcgagggattagtctccgcagttgcgcgcggaggatacccgattt |
220 |
Q |
| |
|
||||| ||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||| |||||| |
|
|
| T |
5394485 |
tgccgcccatttgggtcccacaatgctcgtgggattagtctccgcagttgcacgcggaggatactcgattt |
5394555 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 158 - 216
Target Start/End: Original strand, 17981594 - 17981652
Alignment:
| Q |
158 |
atttgggtcccacaatgctcgagggattagtctccgcagttgcgcgcggaggatacccg |
216 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
17981594 |
atttgggtcccacaatgctcgagagattagtctccgcagttgcgcgcggaggatacccg |
17981652 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 150 - 220
Target Start/End: Complemental strand, 37180053 - 37179983
Alignment:
| Q |
150 |
tgccgtccatttgggtcccacaatgctcgagggattagtctccgcagttgcgcgcggaggatacccgattt |
220 |
Q |
| |
|
||||| ||||||| |||||||||| |||||||||||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
37180053 |
tgccgcccatttgagtcccacaatactcgagggattagtctacgcacttgcgcgcggaggatacccgattt |
37179983 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 158 - 220
Target Start/End: Original strand, 14551571 - 14551633
Alignment:
| Q |
158 |
atttgggtcccacaatgctcgagggattagtctccgcagttgcgcgcggaggatacccgattt |
220 |
Q |
| |
|
|||||||||| |||||||||||||||||| ||||||||||||||||| |||||||| |||||| |
|
|
| T |
14551571 |
atttgggtcctacaatgctcgagggattaatctccgcagttgcgcgcagaggatactcgattt |
14551633 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 150 - 216
Target Start/End: Complemental strand, 31579281 - 31579215
Alignment:
| Q |
150 |
tgccgtccatttgggtcccacaatgctcgagggattagtctccgcagttgcgcgcggaggatacccg |
216 |
Q |
| |
|
||||| |||||| |||||||||||||||||| |||||| ||||||||||||||||||||||||||| |
|
|
| T |
31579281 |
tgccgcccatttaagtcccacaatgctcgaggaattagtttccgcagttgcgcgcggaggatacccg |
31579215 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #8
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 158 - 216
Target Start/End: Complemental strand, 42745160 - 42745102
Alignment:
| Q |
158 |
atttgggtcccacaatgctcgagggattagtctccgcagttgcgcgcggaggatacccg |
216 |
Q |
| |
|
|||||||| |||||||| |||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
42745160 |
atttgggttccacaatggtcgagggattagtctcagcagttgcgcgcggaggatacccg |
42745102 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #9
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 148 - 210
Target Start/End: Complemental strand, 7020414 - 7020352
Alignment:
| Q |
148 |
cttgccgtccatttgggtcccacaatgctcgagggattagtctccgcagttgcgcgcggagga |
210 |
Q |
| |
|
||||||| |||||||||||| |||||||||||| |||||||||| ||||||||||||||||| |
|
|
| T |
7020414 |
cttgccgcccatttgggtcctacaatgctcgagtgattagtctcgacagttgcgcgcggagga |
7020352 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #10
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 150 - 212
Target Start/End: Complemental strand, 9438188 - 9438126
Alignment:
| Q |
150 |
tgccgtccatttgggtcccacaatgctcgagggattagtctccgcagttgcgcgcggaggata |
212 |
Q |
| |
|
||||| ||||||| ||||||||||||| ||||||||||| ||| ||||||||||||||||||| |
|
|
| T |
9438188 |
tgccgcccatttgtgtcccacaatgcttgagggattagtttccacagttgcgcgcggaggata |
9438126 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #11
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 150 - 212
Target Start/End: Complemental strand, 18105414 - 18105353
Alignment:
| Q |
150 |
tgccgtccatttgggtcccacaatgctcgagggattagtctccgcagttgcgcgcggaggata |
212 |
Q |
| |
|
||||| ||||||| ||| |||||| |||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
18105414 |
tgccgcccatttgagtctcacaatactcgagggattagtct-cgcagttgcgcgcggaggata |
18105353 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #12
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 159 - 220
Target Start/End: Original strand, 1682120 - 1682181
Alignment:
| Q |
159 |
tttgggtcccacaatgctcgagggattagtctccgcagttgcgcgcggaggatacccgattt |
220 |
Q |
| |
|
||||||||| | ||| |||||||||||||||||||||||||||| | |||||||||| |||| |
|
|
| T |
1682120 |
tttgggtcctataatactcgagggattagtctccgcagttgcgcacagaggatacccaattt |
1682181 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #13
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 161 - 218
Target Start/End: Complemental strand, 38373035 - 38372978
Alignment:
| Q |
161 |
tgggtcccacaatgctcgagggattagtctccgcagttgcgcgcggaggatacccgat |
218 |
Q |
| |
|
||||||||||||||||| ||| |||||||| ||||||||||||||||||||||||| |
|
|
| T |
38373035 |
tgggtcccacaatgctcaaggaattagtctatacagttgcgcgcggaggatacccgat |
38372978 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #14
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 156 - 220
Target Start/End: Original strand, 17655756 - 17655822
Alignment:
| Q |
156 |
ccatttgggtcccacaatgctcgagggattagtctccgcagttgc--gcgcggaggatacccgattt |
220 |
Q |
| |
|
|||||||| | |||||| ||||||||||||||||||||||||||| ||| |||||||||| ||||| |
|
|
| T |
17655756 |
ccatttggattccacaaggctcgagggattagtctccgcagttgcgtgcgaggaggatacctgattt |
17655822 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #15
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 149 - 211
Target Start/End: Complemental strand, 3562243 - 3562181
Alignment:
| Q |
149 |
ttgccgtccatttgggtcccacaatgctcgagggattagtctccgcagttgcgcgcggaggat |
211 |
Q |
| |
|
|||||| ||||||||||||||||| ||| |||| | |||||| ||||||||||||||| |||| |
|
|
| T |
3562243 |
ttgccgcccatttgggtcccacaaagcttgaggtactagtcttcgcagttgcgcgcggcggat |
3562181 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #16
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 148 - 190
Target Start/End: Complemental strand, 14121936 - 14121894
Alignment:
| Q |
148 |
cttgccgtccatttgggtcccacaatgctcgagggattagtct |
190 |
Q |
| |
|
||||||| ||||||| ||||||||||||||||||||||||||| |
|
|
| T |
14121936 |
cttgccgcccatttgagtcccacaatgctcgagggattagtct |
14121894 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #17
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 153 - 201
Target Start/End: Complemental strand, 39401118 - 39401070
Alignment:
| Q |
153 |
cgtccatttgggtcccacaatgctcgagggattagtctccgcagttgcg |
201 |
Q |
| |
|
||||||||| |||||||||||||||| | |||||| ||||||||||||| |
|
|
| T |
39401118 |
cgtccatttaggtcccacaatgctcgtgagattagactccgcagttgcg |
39401070 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #18
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 148 - 215
Target Start/End: Complemental strand, 13835511 - 13835444
Alignment:
| Q |
148 |
cttgccgtccatttgggtcccacaatgctcgagggattagtctccgcagttgcgcgcggaggataccc |
215 |
Q |
| |
|
|||||||| |||||| ||||||||||| | ||||||||||| || ||||||| | | ||||||||||| |
|
|
| T |
13835511 |
cttgccgttcatttgagtcccacaatgtttgagggattagtttctgcagttgtgtgtggaggataccc |
13835444 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #19
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 148 - 214
Target Start/End: Original strand, 993840 - 993906
Alignment:
| Q |
148 |
cttgccgtccatttgggtcccacaatgctcgagggattagtctccgcagttgcgcgcggaggatacc |
214 |
Q |
| |
|
||||||| |||||||||||| ||||| || | |||||||| ||||| |||||||| |||||||||| |
|
|
| T |
993840 |
cttgccgcccatttgggtcctacaatactgaatggattagtttccgccgttgcgcgtggaggatacc |
993906 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #20
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 158 - 220
Target Start/End: Complemental strand, 24412971 - 24412909
Alignment:
| Q |
158 |
atttgggtcccacaatgctcgagggattagtctccgcagttgcgcgcggaggatacccgattt |
220 |
Q |
| |
|
||||| |||||||||| || |||| |||||||||||||||| ||| ||||||||||| |||| |
|
|
| T |
24412971 |
atttgagtcccacaatacttgaggaattagtctccgcagttccgctaggaggatacccaattt |
24412909 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #21
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 148 - 202
Target Start/End: Original strand, 38743825 - 38743879
Alignment:
| Q |
148 |
cttgccgtccatttgggtcccacaatgctcgagggattagtctccgcagttgcgc |
202 |
Q |
| |
|
||||||| ||||||| || ||||||||| |||||||||||||||||||||||| |
|
|
| T |
38743825 |
cttgccgctcatttggatctcacaatgctttagggattagtctccgcagttgcgc |
38743879 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #22
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 168 - 213
Target Start/End: Complemental strand, 12233109 - 12233064
Alignment:
| Q |
168 |
cacaatgctcgagggattagtctccgcagttgcgcgcggaggatac |
213 |
Q |
| |
|
||||||||||||||||||||||||| ||||| ||| ||||||||| |
|
|
| T |
12233109 |
cacaatgctcgagggattagtctccacagttacgcttggaggatac |
12233064 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 129; Significance: 1e-66; HSPs: 13)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 129; E-Value: 1e-66
Query Start/End: Original strand, 156 - 341
Target Start/End: Original strand, 31113429 - 31113614
Alignment:
| Q |
156 |
ccatttgggtcccacaatgctcgagggattagtctccgcagttgcgcgcggaggatacccgatttnnnnnnnnnnnnnnngtctgaaagtatttacaagg |
255 |
Q |
| |
|
|||||||| ||||||||| ||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||| |
|
|
| T |
31113429 |
ccatttggatcccacaatactcgagggattagtctccgcagttgcgcgcgaaggatacccgatttacacaaaaaaaaaaagtctgaaagtatttacaagg |
31113528 |
T |
 |
| Q |
256 |
ctaccggaaaactaccaaacagcaacaaaatcattattcacatccatagttttgaaaactgattcggtgatcgactcggtaaaggt |
341 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31113529 |
ctaccggaaaactaccaaacagcaacaaaatcattattcacatccatagttttgaaaactgattcggtgatcgactcggtaaaggt |
31113614 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 150 - 215
Target Start/End: Complemental strand, 5123550 - 5123485
Alignment:
| Q |
150 |
tgccgtccatttgggtcccacaatgctcgagggattagtctccgcagttgcgcgcggaggataccc |
215 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5123550 |
tgccgcccatttgggtcccacaatgctcgagggattagtctccgcagttgcgcgcggaggataccc |
5123485 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 59; E-Value: 6e-25
Query Start/End: Original strand, 150 - 220
Target Start/End: Original strand, 10592016 - 10592086
Alignment:
| Q |
150 |
tgccgtccatttgggtcccacaatgctcgagggattagtctccgcagttgcgcgcggaggatacccgattt |
220 |
Q |
| |
|
||||| ||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
10592016 |
tgccgcccatttgagtcccacaatgctcgagggattagtctctgcagttgcgcgcggaggatacccgattt |
10592086 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 158 - 216
Target Start/End: Complemental strand, 22188042 - 22187984
Alignment:
| Q |
158 |
atttgggtcccacaatgctcgagggattagtctccgcagttgcgcgcggaggatacccg |
216 |
Q |
| |
|
|||||||||||||||| || ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22188042 |
atttgggtcccacaatactagagggattagtctccgcagttgcgcgcggaggatacccg |
22187984 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 150 - 214
Target Start/End: Complemental strand, 30785038 - 30784974
Alignment:
| Q |
150 |
tgccgtccatttgggtcccacaatgctcgagggattagtctccgcagttgcgcgcggaggatacc |
214 |
Q |
| |
|
|||| ||||||| |||| ||||||| || |||||||||||||||||||||||||||||||||||| |
|
|
| T |
30785038 |
tgccatccatttaggtctcacaatgttcaagggattagtctccgcagttgcgcgcggaggatacc |
30784974 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 148 - 216
Target Start/End: Original strand, 25983752 - 25983820
Alignment:
| Q |
148 |
cttgccgtccatttgggtcccacaatgctcgagggattagtctccgcagttgcgcgcggaggatacccg |
216 |
Q |
| |
|
||||||| ||||||| |||||| |||| ||||| ||||||||||||||||||| | ||||||||||||| |
|
|
| T |
25983752 |
cttgccgcccatttgagtcccataatgttcgagtgattagtctccgcagttgcacacggaggatacccg |
25983820 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 149 - 220
Target Start/End: Complemental strand, 373817 - 373746
Alignment:
| Q |
149 |
ttgccgtccatttgggtcccacaatgctcgagggattagtctccgcagttgcgcgcggaggatacccgattt |
220 |
Q |
| |
|
|||||||| ||||||||| |||||| || |||||||| ||||||||||||||| |||||||||||| |||| |
|
|
| T |
373817 |
ttgccgtctatttgggtcatacaatgttcaagggattaatctccgcagttgcgcacggaggatacccaattt |
373746 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #8
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 153 - 215
Target Start/End: Original strand, 29553631 - 29553693
Alignment:
| Q |
153 |
cgtccatttgggtcccacaatgctcgagggattagtctccgcagttgcgcgcggaggataccc |
215 |
Q |
| |
|
||||||||||||||||| ||||||| || |||||||||| ||||||| ||| ||||||||||| |
|
|
| T |
29553631 |
cgtccatttgggtcccagaatgctcaagagattagtctctgcagttgtgcgtggaggataccc |
29553693 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #9
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 149 - 198
Target Start/End: Original strand, 36212984 - 36213033
Alignment:
| Q |
149 |
ttgccgtccatttgggtcccacaatgctcgagggattagtctccgcagtt |
198 |
Q |
| |
|
|||||| |||||| ||||||||||||||||||||||| |||||||||||| |
|
|
| T |
36212984 |
ttgccgcccatttaggtcccacaatgctcgagggattggtctccgcagtt |
36213033 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #10
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 168 - 202
Target Start/End: Original strand, 22402074 - 22402108
Alignment:
| Q |
168 |
cacaatgctcgagggattagtctccgcagttgcgc |
202 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| |
|
|
| T |
22402074 |
cacaatgctcgagggattaatctccgcagttgcgc |
22402108 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #11
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 176 - 213
Target Start/End: Original strand, 12682750 - 12682787
Alignment:
| Q |
176 |
tcgagggattagtctccgcagttgcgcgcggaggatac |
213 |
Q |
| |
|
|||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
12682750 |
tcgaggaattagtcttcgcagttgcgcgcggaggatac |
12682787 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #12
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 153 - 220
Target Start/End: Original strand, 5051681 - 5051749
Alignment:
| Q |
153 |
cgtccatttgggtcccacaatgctcgagggattagtctccgc-agttgcgcgcggaggatacccgattt |
220 |
Q |
| |
|
|||||||||| ||| ||||||||||||| ||||||| || || ||||||| || |||||| |||||||| |
|
|
| T |
5051681 |
cgtccatttgagtctcacaatgctcgagagattagtttctgcaagttgcgtgcagaggatgcccgattt |
5051749 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #13
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 156 - 200
Target Start/End: Original strand, 18244679 - 18244723
Alignment:
| Q |
156 |
ccatttgggtcccacaatgctcgagggattagtctccgcagttgc |
200 |
Q |
| |
|
|||||||||| ||||||| || ||| ||||||||||||||||||| |
|
|
| T |
18244679 |
ccatttgggttccacaatacttgagagattagtctccgcagttgc |
18244723 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 67; Significance: 1e-29; HSPs: 16)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 150 - 220
Target Start/End: Complemental strand, 4125076 - 4125006
Alignment:
| Q |
150 |
tgccgtccatttgggtcccacaatgctcgagggattagtctccgcagttgcgcgcggaggatacccgattt |
220 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4125076 |
tgccgcccatttgggtcccacaatgctcgagggattagtctccgcagttgcgcgcggaggatacccgattt |
4125006 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 64; E-Value: 6e-28
Query Start/End: Original strand, 153 - 216
Target Start/End: Original strand, 2744025 - 2744088
Alignment:
| Q |
153 |
cgtccatttgggtcccacaatgctcgagggattagtctccgcagttgcgcgcggaggatacccg |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2744025 |
cgtccatttgggtcccacaatgctcgagggattagtctccgcagttgcgcgcggaggatacccg |
2744088 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 63; E-Value: 3e-27
Query Start/End: Original strand, 150 - 216
Target Start/End: Complemental strand, 7839305 - 7839239
Alignment:
| Q |
150 |
tgccgtccatttgggtcccacaatgctcgagggattagtctccgcagttgcgcgcggaggatacccg |
216 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7839305 |
tgccgcccatttgggtcccacaatgctcgagggattagtctccgcagttgcgcgcggaggatacccg |
7839239 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 52; E-Value: 9e-21
Query Start/End: Original strand, 148 - 214
Target Start/End: Complemental strand, 19715780 - 19715713
Alignment:
| Q |
148 |
cttgccgtccatttgggtcccacaatgctcgaggg-attagtctccgcagttgcgcgcggaggatacc |
214 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||| |
|
|
| T |
19715780 |
cttgccgcccatttgggtcccacaatgctcgaggggattagtctccgcagttgcgcgcggagaatacc |
19715713 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 156 - 210
Target Start/End: Complemental strand, 12958131 - 12958077
Alignment:
| Q |
156 |
ccatttgggtcccacaatgctcgagggattagtctccgcagttgcgcgcggagga |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
12958131 |
ccatttgggtcccacaatgctcgagggattagtctccgcagtagcgcgcggagga |
12958077 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 150 - 216
Target Start/End: Complemental strand, 13468797 - 13468731
Alignment:
| Q |
150 |
tgccgtccatttgggtcccacaatgctcgagggattagtctccgcagttgcgcgcggaggatacccg |
216 |
Q |
| |
|
||||| ||||||| |||||||||||||||| |||||||||||||||||||||| ||||||||||||| |
|
|
| T |
13468797 |
tgccgcccatttgagtcccacaatgctcgaaggattagtctccgcagttgcgcacggaggatacccg |
13468731 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 150 - 216
Target Start/End: Original strand, 30936093 - 30936159
Alignment:
| Q |
150 |
tgccgtccatttgggtcccacaatgctcgagggattagtctccgcagttgcgcgcggaggatacccg |
216 |
Q |
| |
|
||||| |||||||||||| |||||| |||||||||||||||||||||||||||||||| | |||||| |
|
|
| T |
30936093 |
tgccgcccatttgggtccgacaatgttcgagggattagtctccgcagttgcgcgcggatgttacccg |
30936159 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #8
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 164 - 214
Target Start/End: Original strand, 39086855 - 39086905
Alignment:
| Q |
164 |
gtcccacaatgctcgagggattagtctccgcagttgcgcgcggaggatacc |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
39086855 |
gtcccacaatgctcgagggattagtctccgcagttgcacgcggaggatacc |
39086905 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #9
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 156 - 220
Target Start/End: Original strand, 8521793 - 8521856
Alignment:
| Q |
156 |
ccatttgggtcccacaatgctcgagggattagtctccgcagttgcgcgcggaggatacccgattt |
220 |
Q |
| |
|
||||||| ||||||||||||||||||||||||| ||| |||||||||||||| |||||||||||| |
|
|
| T |
8521793 |
ccatttgagtcccacaatgctcgagggattagtatcc-cagttgcgcgcggaagatacccgattt |
8521856 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #10
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 150 - 212
Target Start/End: Complemental strand, 30056053 - 30055991
Alignment:
| Q |
150 |
tgccgtccatttgggtcccacaatgctcgagggattagtctccgcagttgcgcgcggaggata |
212 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||| ||||||| |||| ||||| |
|
|
| T |
30056053 |
tgccgtccatttgggttccacaatgctcgagggattagtctctttagttgcgtgcgggggata |
30055991 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #11
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 156 - 200
Target Start/End: Complemental strand, 36994546 - 36994502
Alignment:
| Q |
156 |
ccatttgggtcccacaatgctcgagggattagtctccgcagttgc |
200 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||| |||||||| |
|
|
| T |
36994546 |
ccatttgggtcccacaaggctcgagggattagtctctgcagttgc |
36994502 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #12
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 148 - 215
Target Start/End: Original strand, 24988586 - 24988653
Alignment:
| Q |
148 |
cttgccgtccatttgggtcccacaatgctcgagggattagtctccgcagttgcgcgcggaggataccc |
215 |
Q |
| |
|
||||||| |||||| |||||||||| ||||||||||||||||||||| |||||| |||||||||| |
|
|
| T |
24988586 |
cttgccgctcatttgagtcccacaatactcgagggattagtctccgcaattgcgcattgaggataccc |
24988653 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #13
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 149 - 220
Target Start/End: Original strand, 40320184 - 40320255
Alignment:
| Q |
149 |
ttgccgtccatttgggtcccacaatgctcgagggattagtctccgcagttgcgcgcggaggatacccgattt |
220 |
Q |
| |
|
|||||||| |||||| |||||| ||||||||| |||||||||| | ||||| |||||||||||||| |||| |
|
|
| T |
40320184 |
ttgccgtctatttggatcccacgatgctcgagagattagtctctgtagttgtacgcggaggatacccaattt |
40320255 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #14
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 152 - 214
Target Start/End: Complemental strand, 13005728 - 13005666
Alignment:
| Q |
152 |
ccgtccatttgggtcccacaatgctcgagggattagtctccgcagttgcgcgcggaggatacc |
214 |
Q |
| |
|
|||||||||| |||||||||| |||| || ||| ||||||||||||| ||||||| |||||| |
|
|
| T |
13005728 |
ccgtccatttaggtcccacaaggctcaagagatcagtctccgcagttctgcgcggaagatacc |
13005666 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #15
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 150 - 191
Target Start/End: Original strand, 15683018 - 15683059
Alignment:
| Q |
150 |
tgccgtccatttgggtcccacaatgctcgagggattagtctc |
191 |
Q |
| |
|
||||| |||||| |||||||||||||||||||||||| |||| |
|
|
| T |
15683018 |
tgccgcccatttaggtcccacaatgctcgagggattaatctc |
15683059 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #16
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 149 - 220
Target Start/End: Complemental strand, 16700650 - 16700578
Alignment:
| Q |
149 |
ttgccgtccatttgggtcccacaatgctcgagggattagtctccgca-gttgcgcgcggaggatacccgattt |
220 |
Q |
| |
|
||||| ||||||| |||| |||| |||||||| ||||||||| || ||||||||||||||||||| ||||| |
|
|
| T |
16700650 |
ttgccatccatttaagtccaacaaagctcgaggaattagtctctacaagttgcgcgcggaggatacctgattt |
16700578 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 65; Significance: 2e-28; HSPs: 22)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 148 - 220
Target Start/End: Original strand, 9012357 - 9012429
Alignment:
| Q |
148 |
cttgccgtccatttgggtcccacaatgctcgagggattagtctccgcagttgcgcgcggaggatacccgattt |
220 |
Q |
| |
|
||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9012357 |
cttgccgcccacttgggtcccacaatgctcgagggattagtctccgcagttgcgcgcggaggatacccgattt |
9012429 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 63; E-Value: 3e-27
Query Start/End: Original strand, 150 - 216
Target Start/End: Complemental strand, 31307118 - 31307052
Alignment:
| Q |
150 |
tgccgtccatttgggtcccacaatgctcgagggattagtctccgcagttgcgcgcggaggatacccg |
216 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31307118 |
tgccgcccatttgggtcccacaatgctcgagggattagtctccgcagttgcgcgcggaggatacccg |
31307052 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 63; E-Value: 3e-27
Query Start/End: Original strand, 150 - 220
Target Start/End: Original strand, 38766178 - 38766248
Alignment:
| Q |
150 |
tgccgtccatttgggtcccacaatgctcgagggattagtctccgcagttgcgcgcggaggatacccgattt |
220 |
Q |
| |
|
||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38766178 |
tgccgcccatttgggtctcacaatgctcgagggattagtctccgcagttgcgcgcggaggatacccgattt |
38766248 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 63; E-Value: 3e-27
Query Start/End: Original strand, 150 - 220
Target Start/End: Complemental strand, 51626358 - 51626288
Alignment:
| Q |
150 |
tgccgtccatttgggtcccacaatgctcgagggattagtctccgcagttgcgcgcggaggatacccgattt |
220 |
Q |
| |
|
|||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51626358 |
tgccgtccatttgggtcccacagtgctcgagagattagtctccgcagttgcgcgcggaggatacccgattt |
51626288 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 148 - 216
Target Start/End: Original strand, 14854692 - 14854760
Alignment:
| Q |
148 |
cttgccgtccatttgggtcccacaatgctcgagggattagtctccgcagttgcgcgcggaggatacccg |
216 |
Q |
| |
|
||||||| |||||||||||| ||||| ||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
14854692 |
cttgccgcccatttgggtccaacaattctcgagggattagtctctgcagttgcgcgcggaggatacccg |
14854760 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 150 - 220
Target Start/End: Original strand, 46016238 - 46016308
Alignment:
| Q |
150 |
tgccgtccatttgggtcccacaatgctcgagggattagtctccgcagttgcgcgcggaggatacccgattt |
220 |
Q |
| |
|
||||| |||||||||||||||||||||||| | ||||||||||| ||||||||| |||||||||||||||| |
|
|
| T |
46016238 |
tgccgcccatttgggtcccacaatgctcgaagaattagtctccgtagttgcgcgtggaggatacccgattt |
46016308 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 148 - 213
Target Start/End: Original strand, 33529344 - 33529409
Alignment:
| Q |
148 |
cttgccgtccatttgggtcccacaatgctcgagggattagtctccgcagttgcgcgcggaggatac |
213 |
Q |
| |
|
||||||| |||||||||||||||||| || ||||||||||||||||||||||||| |||||||||| |
|
|
| T |
33529344 |
cttgccgcccatttgggtcccacaatactggagggattagtctccgcagttgcgcacggaggatac |
33529409 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 149 - 214
Target Start/End: Original strand, 35972431 - 35972496
Alignment:
| Q |
149 |
ttgccgtccatttgggtcccacaatgctcgagggattagtctccgcagttgcgcgcggaggatacc |
214 |
Q |
| |
|
|||||| ||||||||||||||| ||| |||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
35972431 |
ttgccgcccatttgggtcccactatgttcgagggattagtctccgcagttgcgtgcggaggatacc |
35972496 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #9
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 148 - 214
Target Start/End: Original strand, 15133462 - 15133528
Alignment:
| Q |
148 |
cttgccgtccatttgggtcccacaatgctcgagggattagtctccgcagttgcgcgcggaggatacc |
214 |
Q |
| |
|
|||| ||||| |||||||||||||||| | ||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
15133462 |
cttgtcgtccgtttgggtcccacaatgtttgagagattagtctccgcagttgcgcgcggaggatacc |
15133528 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #10
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 151 - 212
Target Start/End: Complemental strand, 35334149 - 35334088
Alignment:
| Q |
151 |
gccgtccatttgggtcccacaatgctcgagggattagtctccgcagttgcgcgcggaggata |
212 |
Q |
| |
|
|||| |||||||||||||||||| ||||||||||||||||||||||||||||| | |||||| |
|
|
| T |
35334149 |
gccgcccatttgggtcccacaatactcgagggattagtctccgcagttgcgcgtgaaggata |
35334088 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #11
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 11 - 95
Target Start/End: Original strand, 17345557 - 17345641
Alignment:
| Q |
11 |
cacagattgaatctgtcactaatgataacttgattgttagtgttttcaatagcttggatcaacctttccttatttcttggttagt |
95 |
Q |
| |
|
|||||||||| || || ||||||||||| |||||| | | |||||| |||||||||||| |||||||||| |||||||||||||| |
|
|
| T |
17345557 |
cacagattgagtcagtgactaatgataatttgattatcaatgtttttaatagcttggatgaacctttcctcatttcttggttagt |
17345641 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #12
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 11 - 93
Target Start/End: Complemental strand, 17138960 - 17138878
Alignment:
| Q |
11 |
cacagattgaatctgtcactaatgataacttgattgttagtgttttcaatagcttggatcaacctttccttatttcttggtta |
93 |
Q |
| |
|
|||||||||| || || ||||||||||| |||||| | | ||||||||| ||||||||| |||||||||| |||||||||||| |
|
|
| T |
17138960 |
cacagattgagtcagtgactaatgataatttgattatcaatgttttcaacagcttggatgaacctttcctcatttcttggtta |
17138878 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #13
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 152 - 207
Target Start/End: Complemental strand, 13948642 - 13948587
Alignment:
| Q |
152 |
ccgtccatttgggtcccacaatgctcgagggattagtctccgcagttgcgcgcgga |
207 |
Q |
| |
|
||||||||||| || |||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
13948642 |
ccgtccatttgaatctcacaatgctcgagggattagtctctgcagttgcgcgcgga |
13948587 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #14
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 156 - 215
Target Start/End: Original strand, 45994617 - 45994676
Alignment:
| Q |
156 |
ccatttgggtcccacaatgctcgagggattagtctccgcagttgcgcgcggaggataccc |
215 |
Q |
| |
|
||||||||||| ||||||||||||| ||||||||||||||||||| ||| ||||||||| |
|
|
| T |
45994617 |
ccatttgggtctcacaatgctcgagagattagtctccgcagttgcacgccaaggataccc |
45994676 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #15
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 149 - 200
Target Start/End: Original strand, 13686690 - 13686741
Alignment:
| Q |
149 |
ttgccgtccatttgggtcccacaatgctcgagggattagtctccgcagttgc |
200 |
Q |
| |
|
|||||||||||||||||| ||||| ||||||| ||||||||||| ||||||| |
|
|
| T |
13686690 |
ttgccgtccatttgggtctcacaaggctcgagagattagtctccacagttgc |
13686741 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #16
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 150 - 212
Target Start/End: Complemental strand, 46250607 - 46250545
Alignment:
| Q |
150 |
tgccgtccatttgggtcccacaatgctcgagggattagtctccgcagttgcgcgcggaggata |
212 |
Q |
| |
|
||||| ||||||||||||||| |||||||| | |||||||||||| |||| ||| |||||||| |
|
|
| T |
46250607 |
tgccgcccatttgggtcccacgatgctcgaagaattagtctccgcggttgtgcgtggaggata |
46250545 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #17
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 149 - 205
Target Start/End: Complemental strand, 25768741 - 25768685
Alignment:
| Q |
149 |
ttgccgtccatttgggtcccacaatgctcgagggattagtctccgcagttgcgcgcg |
205 |
Q |
| |
|
|||||| |||||||||| |||||||||| || |||||||||||| || ||||||||| |
|
|
| T |
25768741 |
ttgccgcccatttgggtgccacaatgcttgaaggattagtctccacaattgcgcgcg |
25768685 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #18
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 184 - 220
Target Start/End: Complemental strand, 37241394 - 37241358
Alignment:
| Q |
184 |
ttagtctccgcagttgcgcgcggaggatacccgattt |
220 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
37241394 |
ttagtctccgcagttgcgcgcggaggatacctgattt |
37241358 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #19
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 149 - 214
Target Start/End: Original strand, 18841573 - 18841639
Alignment:
| Q |
149 |
ttgccgtccatttgggtcccacaatgctcgagggattagtctccgc-agttgcgcgcggaggatacc |
214 |
Q |
| |
|
|||||| | |||||| ||| |||| |||| |||||||||||||||| |||||||| ||||||||||| |
|
|
| T |
18841573 |
ttgccgccaatttggatcctacaaggctcaagggattagtctccgcaagttgcgcacggaggatacc |
18841639 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #20
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 149 - 203
Target Start/End: Complemental strand, 36990147 - 36990093
Alignment:
| Q |
149 |
ttgccgtccatttgggtcccacaatgctcgagggattagtctccgcagttgcgcg |
203 |
Q |
| |
|
|||||||||||||| ||||||||||||||||| |||||| | ||||||| |||| |
|
|
| T |
36990147 |
ttgccgtccatttgaatcccacaatgctcgaggaattagtattcgcagttacgcg |
36990093 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #21
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 171 - 216
Target Start/End: Complemental strand, 32005177 - 32005132
Alignment:
| Q |
171 |
aatgctcgagggattagtctccgcagttgcgcgcggaggatacccg |
216 |
Q |
| |
|
|||||||||| |||||||||||||| || |||||||||||||||| |
|
|
| T |
32005177 |
aatgctcgagagattagtctccgcaattatgcgcggaggatacccg |
32005132 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #22
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 149 - 193
Target Start/End: Original strand, 51853784 - 51853828
Alignment:
| Q |
149 |
ttgccgtccatttgggtcccacaatgctcgagggattagtctccg |
193 |
Q |
| |
|
|||| |||||||| |||| |||||| ||||||||||||||||||| |
|
|
| T |
51853784 |
ttgcggtccattttggtctcacaatactcgagggattagtctccg |
51853828 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 61; Significance: 4e-26; HSPs: 19)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 61; E-Value: 4e-26
Query Start/End: Original strand, 150 - 214
Target Start/End: Complemental strand, 42297494 - 42297430
Alignment:
| Q |
150 |
tgccgtccatttgggtcccacaatgctcgagggattagtctccgcagttgcgcgcggaggatacc |
214 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42297494 |
tgccgtccatttgggtctcacaatgctcgagggattagtctccgcagttgcgcgcggaggatacc |
42297430 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 149 - 220
Target Start/End: Original strand, 15642543 - 15642614
Alignment:
| Q |
149 |
ttgccgtccatttgggtcccacaatgctcgagggattagtctccgcagttgcgcgcggaggatacccgattt |
220 |
Q |
| |
|
|||||| ||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
15642543 |
ttgccgcccatttgggtcccacaatgctcgagagattattctccgcagttgcgcgcggaggatacccgattt |
15642614 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 157 - 220
Target Start/End: Original strand, 16756178 - 16756241
Alignment:
| Q |
157 |
catttgggtcccacaatgctcgagggattagtctccgcagttgcgcgcggaggatacccgattt |
220 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
16756178 |
catttgggtcccacaatgctcgagggattagtctccgcagttgcgcgcggaggatactcgattt |
16756241 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 166 - 220
Target Start/End: Complemental strand, 18428178 - 18428124
Alignment:
| Q |
166 |
cccacaatgctcgagggattagtctccgcagttgcgcgcggaggatacccgattt |
220 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
18428178 |
cccacaatgctcgagggattagtctctgcagttgcgcgcggaggatacccgattt |
18428124 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 150 - 216
Target Start/End: Original strand, 28724761 - 28724827
Alignment:
| Q |
150 |
tgccgtccatttgggtcccacaatgctcgagggattagtctccgcagttgcgcgcggaggatacccg |
216 |
Q |
| |
|
||||||||||||| |||| |||||| |||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
28724761 |
tgccgtccatttgagtcctacaatgttcgagggattagtctccgcaattgcgcgcggaggatacccg |
28724827 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 150 - 216
Target Start/End: Original strand, 36806700 - 36806766
Alignment:
| Q |
150 |
tgccgtccatttgggtcccacaatgctcgagggattagtctccgcagttgcgcgcggaggatacccg |
216 |
Q |
| |
|
||||| |||||||||| ||||||||||||||||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
36806700 |
tgccgcccatttgggttccacaatgctcgagggattagtctctgcagttgcacgcggaggatacccg |
36806766 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 150 - 220
Target Start/End: Original strand, 49071666 - 49071736
Alignment:
| Q |
150 |
tgccgtccatttgggtcccacaatgctcgagggattagtctccgcagttgcgcgcggaggatacccgattt |
220 |
Q |
| |
|
|||||| |||||||||||||||||||||||| |||||||||||||||||||| ||||| |||| ||||||| |
|
|
| T |
49071666 |
tgccgttcatttgggtcccacaatgctcgagagattagtctccgcagttgcgtgcggaagatatccgattt |
49071736 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #8
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 151 - 215
Target Start/End: Complemental strand, 9781040 - 9780976
Alignment:
| Q |
151 |
gccgtccatttgggtcccacaatgctcgagggattagtctccgcagttgcgcgcggaggataccc |
215 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||| |||| ||||| |||||||| |||||| |
|
|
| T |
9781040 |
gccgcccatttgggtcccacaatgctcgagggattagtatccgtagttgggcgcggagaataccc |
9780976 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #9
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 148 - 220
Target Start/End: Original strand, 46864178 - 46864250
Alignment:
| Q |
148 |
cttgccgtccatttgggtcccacaatgctcgagggattagtctccgcagttgcgcgcggaggatacccgattt |
220 |
Q |
| |
|
|||||||||||||||||| ||||||| |||||||||||||||| |||||||||||| |||||||| ||||| |
|
|
| T |
46864178 |
cttgccgtccatttgggtttcacaatgttcgagggattagtctctgcagttgcgcgcaaaggatacctgattt |
46864250 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #10
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 156 - 215
Target Start/End: Original strand, 22022215 - 22022274
Alignment:
| Q |
156 |
ccatttgggtcccacaatgctcgagggattagtctccgcagttgcgcgcggaggataccc |
215 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||| || ||||||||||| |
|
|
| T |
22022215 |
ccatttgggtcccacaatattcgagggattagtctccgcagttgcacgtggaggataccc |
22022274 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #11
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 150 - 220
Target Start/End: Original strand, 12035639 - 12035709
Alignment:
| Q |
150 |
tgccgtccatttgggtcccacaatgctcgagggattagtctccgcagttgcgcgcggaggatacccgattt |
220 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||| ||| |||| || ||| ||||| |||||| |
|
|
| T |
12035639 |
tgccgcccatttgggtcccacaatgctcgagggattagtctcagcaattgcacgtggatgatactcgattt |
12035709 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #12
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 148 - 214
Target Start/End: Original strand, 44913196 - 44913262
Alignment:
| Q |
148 |
cttgccgtccatttgggtcccacaatgctcgagggattagtctccgcagttgcgcgcggaggatacc |
214 |
Q |
| |
|
||||||| |||| |||||||||||||||||||| |||||||||| |||||| ||||| ||||||||| |
|
|
| T |
44913196 |
cttgccgcccatctgggtcccacaatgctcgagagattagtctctgcagttacgcgcagaggatacc |
44913262 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #13
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 156 - 220
Target Start/End: Original strand, 10367599 - 10367663
Alignment:
| Q |
156 |
ccatttgggtcccacaatgctcgagggattagtctccgcagttgcgcgcggaggatacccgattt |
220 |
Q |
| |
|
|||||||||||| ||||||||||| |||||| |||||||||||||| ||| || ||||||||||| |
|
|
| T |
10367599 |
ccatttgggtccaacaatgctcgaaggattaatctccgcagttgcgtgcgaagaatacccgattt |
10367663 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #14
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 148 - 220
Target Start/End: Original strand, 10750684 - 10750756
Alignment:
| Q |
148 |
cttgccgtccatttgggtcccacaatgctcgagggattagtctccgcagttgcgcgcggaggatacccgattt |
220 |
Q |
| |
|
||||||| |||||||| || ||||||| ||||||||||||||| ||||||||||| ||||||||| ||||| |
|
|
| T |
10750684 |
cttgccgcccatttggatcgcacaatgttcgagggattagtctttacagttgcgcgcagaggatacctgattt |
10750756 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #15
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 175 - 214
Target Start/End: Complemental strand, 7242834 - 7242795
Alignment:
| Q |
175 |
ctcgagggattagtctccgcagttgcgcgcggaggatacc |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
7242834 |
ctcgagggattagtctccgcagttgcgcgcggaagatacc |
7242795 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #16
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 157 - 205
Target Start/End: Complemental strand, 6607739 - 6607691
Alignment:
| Q |
157 |
catttgggtcccacaatgctcgagggattagtctccgcagttgcgcgcg |
205 |
Q |
| |
|
||||| |||| ||||||||||||||||||||||||||||| ||| |||| |
|
|
| T |
6607739 |
catttaggtctcacaatgctcgagggattagtctccgcagctgcacgcg |
6607691 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #17
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 163 - 214
Target Start/End: Original strand, 32534184 - 32534235
Alignment:
| Q |
163 |
ggtcccacaatgctcgagggattagtctccgcagttgcgcgcggaggatacc |
214 |
Q |
| |
|
|||| ||||||||||||| | |||||||||||| |||||||| ||||||||| |
|
|
| T |
32534184 |
ggtctcacaatgctcgagaggttagtctccgcaattgcgcgcagaggatacc |
32534235 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #18
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 158 - 220
Target Start/End: Original strand, 2044494 - 2044556
Alignment:
| Q |
158 |
atttgggtcccacaatgctcgagggattagtctccgcagttgcgcgcggaggatacccgattt |
220 |
Q |
| |
|
|||||||| ||||||||||| || |||||||||| |||||| |||| ||| ||||||||||| |
|
|
| T |
2044494 |
atttgggttccacaatgctcaagagattagtctctgcagtttcgcgtagagaatacccgattt |
2044556 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #19
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 158 - 211
Target Start/End: Complemental strand, 39547408 - 39547355
Alignment:
| Q |
158 |
atttgggtcccacaatgctcgagggattagtctccgcagttgcgcgcggaggat |
211 |
Q |
| |
|
|||| |||| ||||||| |||| |||||| ||||||||||||||||| |||||| |
|
|
| T |
39547408 |
atttaggtctcacaatgttcgacggattaatctccgcagttgcgcgcagaggat |
39547355 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 59; Significance: 6e-25; HSPs: 26)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 59; E-Value: 6e-25
Query Start/End: Original strand, 150 - 216
Target Start/End: Original strand, 29059894 - 29059960
Alignment:
| Q |
150 |
tgccgtccatttgggtcccacaatgctcgagggattagtctccgcagttgcgcgcggaggatacccg |
216 |
Q |
| |
|
||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29059894 |
tgccgcccatttgggtcccacaatgcttgagggattagtctccgcagttgcgcgcggaggatacccg |
29059960 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 59; E-Value: 6e-25
Query Start/End: Original strand, 150 - 216
Target Start/End: Original strand, 31492192 - 31492258
Alignment:
| Q |
150 |
tgccgtccatttgggtcccacaatgctcgagggattagtctccgcagttgcgcgcggaggatacccg |
216 |
Q |
| |
|
||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31492192 |
tgccgcccatttaggtcccacaatgctcgagggattagtctccgcagttgcgcgcggaggatacccg |
31492258 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 158 - 220
Target Start/End: Complemental strand, 37339777 - 37339715
Alignment:
| Q |
158 |
atttgggtcccacaatgctcgagggattagtctccgcagttgcgcgcggaggatacccgattt |
220 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
37339777 |
atttgggtcccataatgctcgagggattagtctccgcagttgcgcacggaggatacccgattt |
37339715 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 158 - 215
Target Start/End: Original strand, 28665187 - 28665244
Alignment:
| Q |
158 |
atttgggtcccacaatgctcgagggattagtctccgcagttgcgcgcggaggataccc |
215 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
28665187 |
attttggtcccacaatgctcgagggattagtctccgcagttgcacgcggaggataccc |
28665244 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 156 - 214
Target Start/End: Complemental strand, 21747086 - 21747028
Alignment:
| Q |
156 |
ccatttgggtcccacaatgctcgagggattagtctccgcagttgcgcgcggaggatacc |
214 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||| |||||||| |||||||||||||| |
|
|
| T |
21747086 |
ccatttgggtcccacaatcctcgagggattagtcttcgcagttgtgcgcggaggatacc |
21747028 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 148 - 216
Target Start/End: Complemental strand, 11486798 - 11486730
Alignment:
| Q |
148 |
cttgccgtccatttgggtcccacaatgctcgagggattagtctccgcagttgcgcgcggaggatacccg |
216 |
Q |
| |
|
||||||| |||||||||| ||||||||||| || |||||||||| ||||||||||||||||||||||| |
|
|
| T |
11486798 |
cttgccgcccatttgggttccacaatgctcaagagattagtctctacagttgcgcgcggaggatacccg |
11486730 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 148 - 203
Target Start/End: Complemental strand, 19477303 - 19477249
Alignment:
| Q |
148 |
cttgccgtccatttgggtcccacaatgctcgagggattagtctccgcagttgcgcg |
203 |
Q |
| |
|
||||||| ||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
19477303 |
cttgccggccatttgggtcccacaatgct-gagggattagtctccgcagttgcgcg |
19477249 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #8
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 156 - 214
Target Start/End: Original strand, 31776513 - 31776571
Alignment:
| Q |
156 |
ccatttgggtcccacaatgctcgagggattagtctccgcagttgcgcgcggaggatacc |
214 |
Q |
| |
|
|||||||||||||||||| |||||||||||| ||| |||||||||| |||||||||||| |
|
|
| T |
31776513 |
ccatttgggtcccacaatactcgagggattaatcttcgcagttgcgggcggaggatacc |
31776571 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #9
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 148 - 213
Target Start/End: Original strand, 20207584 - 20207649
Alignment:
| Q |
148 |
cttgccgtccatttgggtcccacaatgctcgagggattagtctccgcagttgcgcgcggaggatac |
213 |
Q |
| |
|
||||||| ||||||| ||| |||||||||||||||||||||||||||||||||| | |||||||| |
|
|
| T |
20207584 |
cttgccgcgcatttggatcctacaatgctcgagggattagtctccgcagttgcgcacagaggatac |
20207649 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #10
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 148 - 216
Target Start/End: Original strand, 24172296 - 24172364
Alignment:
| Q |
148 |
cttgccgtccatttgggtcccacaatgctcgagggattagtctccgcagttgcgcgcggaggatacccg |
216 |
Q |
| |
|
||||||| ||| |||| ||||||||||||||| |||||||||| |||||||||||||||| ||||||| |
|
|
| T |
24172296 |
cttgccgcccacttggatcccacaatgctcgaaggattagtctatgcagttgcgcgcggagtatacccg |
24172364 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #11
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 156 - 216
Target Start/End: Original strand, 35707941 - 35708001
Alignment:
| Q |
156 |
ccatttgggtcccacaatgctcgagggattagtctccgcagttgcgcgcggaggatacccg |
216 |
Q |
| |
|
|||||| | ||| ||||||||||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
35707941 |
ccatttagatcctacaatgctcgagggattagtctctgcagttgcgcgtggaggatacccg |
35708001 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #12
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 156 - 220
Target Start/End: Complemental strand, 42741854 - 42741791
Alignment:
| Q |
156 |
ccatttgggtcccacaatgctcgagggattagtctccgcagttgcgcgcggaggatacccgattt |
220 |
Q |
| |
|
|||||||||||| | ||| |||||||||||| |||| |||||||||||||||||||||||||||| |
|
|
| T |
42741854 |
ccatttgggtcc-ataatactcgagggattaatctctgcagttgcgcgcggaggatacccgattt |
42741791 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #13
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 149 - 202
Target Start/End: Complemental strand, 29428845 - 29428792
Alignment:
| Q |
149 |
ttgccgtccatttgggtcccacaatgctcgagggattagtctccgcagttgcgc |
202 |
Q |
| |
|
|||||| |||||||| |||||||||| |||||||||||||||| |||||||||| |
|
|
| T |
29428845 |
ttgccgaccatttggatcccacaatgttcgagggattagtctctgcagttgcgc |
29428792 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #14
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 169 - 213
Target Start/End: Complemental strand, 36821113 - 36821069
Alignment:
| Q |
169 |
acaatgctcgagggattagtctccgcagttgcgcgcggaggatac |
213 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||| |||||||| |
|
|
| T |
36821113 |
acaatgctcgagggattagtctctgcagttgcgcgcagaggatac |
36821069 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #15
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 148 - 212
Target Start/End: Original strand, 32470003 - 32470069
Alignment:
| Q |
148 |
cttgccgtccatttgggtcccacaat--gctcgagggattagtctccgcagttgcgcgcggaggata |
212 |
Q |
| |
|
||||||||||||||||||| |||||| ||||||| ||||||| | ||||||||| ||||||||||| |
|
|
| T |
32470003 |
cttgccgtccatttgggtctcacaatatgctcgagagattagtgttcgcagttgcacgcggaggata |
32470069 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #16
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 148 - 220
Target Start/End: Original strand, 46373760 - 46373834
Alignment:
| Q |
148 |
cttgccgtccatttgggtcccacaatgctcgagggattagtctccgcagtt--gcgcgcggaggatacccgattt |
220 |
Q |
| |
|
||||||| | ||||||||| ||||||||||||| ||||||||| |||||| ||||||||| |||||||||||| |
|
|
| T |
46373760 |
cttgccgcctatttgggtcacacaatgctcgagagattagtcttggcagtttcgcgcgcggaagatacccgattt |
46373834 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #17
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 150 - 188
Target Start/End: Original strand, 14545032 - 14545070
Alignment:
| Q |
150 |
tgccgtccatttgggtcccacaatgctcgagggattagt |
188 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
14545032 |
tgccgtccatttgggtcccacaatgctcgatggattagt |
14545070 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #18
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 153 - 211
Target Start/End: Complemental strand, 28828814 - 28828756
Alignment:
| Q |
153 |
cgtccatttgggtcccacaatgctcgagggattagtctccgcagttgcgcgcggaggat |
211 |
Q |
| |
|
|||||||||||||| ||||| |||| | |||||||||| ||||||||| |||||||||| |
|
|
| T |
28828814 |
cgtccatttgggtctcacaaggctcaatggattagtctgcgcagttgctcgcggaggat |
28828756 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #19
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 155 - 220
Target Start/End: Original strand, 3231313 - 3231378
Alignment:
| Q |
155 |
tccatttgggtcccacaatgctcgagggattagtctccgcagttgcgcgcggaggatacccgattt |
220 |
Q |
| |
|
||||||| |||||||||||| ||||| |||||| ||| |||||| ||||||||||||||||||| |
|
|
| T |
3231313 |
tccatttaggtcccacaatgttcgagagattagactcaccagttgtacgcggaggatacccgattt |
3231378 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #20
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 150 - 216
Target Start/End: Original strand, 28537479 - 28537541
Alignment:
| Q |
150 |
tgccgtccatttgggtcccacaatgctcgagggattagtctccgcagttgcgcgcggaggatacccg |
216 |
Q |
| |
|
||||| |||||||||||| ||||| ||||||||||||||||||||||| |||| |||||||||| |
|
|
| T |
28537479 |
tgccgcccatttgggtcc----atgcttgagggattagtctccgcagttgcacgcgaaggatacccg |
28537541 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #21
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 153 - 214
Target Start/End: Original strand, 45778956 - 45779017
Alignment:
| Q |
153 |
cgtccatttgggtcccacaatgctcgagggattagtctccgcagttgcgcgcggaggatacc |
214 |
Q |
| |
|
||||| |||| ||| |||||| ||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
45778956 |
cgtccgtttgagtctcacaatactcgagggattagtctccgcagttgcgaatggaggatacc |
45779017 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #22
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 157 - 204
Target Start/End: Original strand, 1424669 - 1424716
Alignment:
| Q |
157 |
catttgggtcccacaatgctcgagggattagtctccgcagttgcgcgc |
204 |
Q |
| |
|
|||||||||||||||| || ||| ||||||||||||||||||||||| |
|
|
| T |
1424669 |
catttgggtcccacaagacttgagagattagtctccgcagttgcgcgc |
1424716 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #23
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 165 - 220
Target Start/End: Complemental strand, 8839318 - 8839262
Alignment:
| Q |
165 |
tcccacaatgctcgagggattagtctccgcagttgcg--cgcggaggatacccgattt |
220 |
Q |
| |
|
||||||||| ||||||||||||||||||||| ||||| |||||| |||||||||||| |
|
|
| T |
8839318 |
tcccacaatactcgagggattagtctccgcaattgcgcacgcgga-gatacccgattt |
8839262 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #24
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 183 - 216
Target Start/End: Original strand, 14552482 - 14552515
Alignment:
| Q |
183 |
attagtctccgcagttgcgcgcggaggatacccg |
216 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||| |
|
|
| T |
14552482 |
attagtctccgcagttgcgcgcagaggatacccg |
14552515 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #25
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 150 - 186
Target Start/End: Complemental strand, 13254153 - 13254117
Alignment:
| Q |
150 |
tgccgtccatttgggtcccacaatgctcgagggatta |
186 |
Q |
| |
|
||||| |||||| |||||||||||||||||||||||| |
|
|
| T |
13254153 |
tgccgcccatttaggtcccacaatgctcgagggatta |
13254117 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #26
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 148 - 216
Target Start/End: Original strand, 33299166 - 33299234
Alignment:
| Q |
148 |
cttgccgtccatttgggtcccacaatgctcgagggattagtctccgcagttgcgcgcggaggatacccg |
216 |
Q |
| |
|
|||||| ||||||||| | |||||||||| | |||||||||||||||||| ||| |||| ||||||| |
|
|
| T |
33299166 |
cttgccatccatttggattccacaatgcttaatggattagtctccgcagttatgcgtggagaatacccg |
33299234 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 59; Significance: 6e-25; HSPs: 20)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 59; E-Value: 6e-25
Query Start/End: Original strand, 158 - 216
Target Start/End: Original strand, 8757441 - 8757499
Alignment:
| Q |
158 |
atttgggtcccacaatgctcgagggattagtctccgcagttgcgcgcggaggatacccg |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8757441 |
atttgggtcccacaatgctcgagggattagtctccgcagttgcgcgcggaggatacccg |
8757499 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 148 - 220
Target Start/End: Original strand, 38331215 - 38331287
Alignment:
| Q |
148 |
cttgccgtccatttgggtcccacaatgctcgagggattagtctccgcagttgcgcgcggaggatacccgattt |
220 |
Q |
| |
|
||||||| ||||||||||||||||||| | ||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
38331215 |
cttgccgcccatttgggtcccacaatgtttgagggattagtctccgcagttgcacgcggaggatacccgattt |
38331287 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 148 - 220
Target Start/End: Complemental strand, 48204365 - 48204293
Alignment:
| Q |
148 |
cttgccgtccatttgggtcccacaatgctcgagggattagtctccgcagttgcgcgcggaggatacccgattt |
220 |
Q |
| |
|
|||| ||||||||||||| ||||||||||| |||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
48204365 |
cttgtcgtccatttgggttccacaatgctcaagggattagtttccgcagttgcgcgcggaggatacccgattt |
48204293 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 150 - 212
Target Start/End: Original strand, 27763810 - 27763872
Alignment:
| Q |
150 |
tgccgtccatttgggtcccacaatgctcgagggattagtctccgcagttgcgcgcggaggata |
212 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
27763810 |
tgccgtccatttgagtcccacaatgctcgagggattagtctccgcagttgcgcgcagaggata |
27763872 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 150 - 212
Target Start/End: Complemental strand, 30996017 - 30995955
Alignment:
| Q |
150 |
tgccgtccatttgggtcccacaatgctcgagggattagtctccgcagttgcgcgcggaggata |
212 |
Q |
| |
|
||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30996017 |
tgccgcccatctgggtcccacaatgctcgagggattagtctccgcagttgcgcgcggaggata |
30995955 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 152 - 220
Target Start/End: Original strand, 1642697 - 1642765
Alignment:
| Q |
152 |
ccgtccatttgggtcccacaatgctcgagggattagtctccgcagttgcgcgcggaggatacccgattt |
220 |
Q |
| |
|
|||||||||||||||||||||| || ||||||||||| ||||||||||||||||||||||| ||||||| |
|
|
| T |
1642697 |
ccgtccatttgggtcccacaatacttgagggattagtttccgcagttgcgcgcggaggatatccgattt |
1642765 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 148 - 216
Target Start/End: Original strand, 25224786 - 25224854
Alignment:
| Q |
148 |
cttgccgtccatttgggtcccacaatgctcgagggattagtctccgcagttgcgcgcggaggatacccg |
216 |
Q |
| |
|
||||||| |||||| ||||||||||||||| |||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
25224786 |
cttgccgcccatttaggtcccacaatgctcaagggattagtctccgcagttgcacgcggaggatacccg |
25224854 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 156 - 220
Target Start/End: Original strand, 55123192 - 55123256
Alignment:
| Q |
156 |
ccatttgggtcccacaatgctcgagggattagtctccgcagttgcgcgcggaggatacccgattt |
220 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||| ||||| |
|
|
| T |
55123192 |
ccatttgggtctcacaatgctcgagggattagtcttcgcagttgcgcgcggaggatacctgattt |
55123256 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #9
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 150 - 215
Target Start/End: Original strand, 20861337 - 20861402
Alignment:
| Q |
150 |
tgccgtccatttgggtcccacaatgctcgagggattagtctccgcagttgcgcgcggaggataccc |
215 |
Q |
| |
|
||||| |||||||||| ||| ||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
20861337 |
tgccgcccatttgggttccataatgctcgagggattagtctccgcagttgtgcgcggaggataccc |
20861402 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #10
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 169 - 216
Target Start/End: Complemental strand, 40318482 - 40318435
Alignment:
| Q |
169 |
acaatgctcgagggattagtctccgcagttgcgcgcggaggatacccg |
216 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40318482 |
acaatgttcgagggattagtctccgcagttgcgcgcggaggatacccg |
40318435 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #11
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 157 - 220
Target Start/End: Original strand, 39950308 - 39950371
Alignment:
| Q |
157 |
catttgggtcccacaatgctcgagggattagtctccgcagttgcgcgcggaggatacccgattt |
220 |
Q |
| |
|
||||||| ||| ||||||||||| |||||||||||||||||||| ||||||||||||| |||| |
|
|
| T |
39950308 |
catttggatccgacaatgctcgaaggattagtctccgcagttgcatgcggaggatacccaattt |
39950371 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #12
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 149 - 212
Target Start/End: Complemental strand, 44941317 - 44941255
Alignment:
| Q |
149 |
ttgccgtccatttgggtcccacaatgctcgagggattagtctccgcagttgcgcgcggaggata |
212 |
Q |
| |
|
|||||| |||||||| ||||| |||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
44941317 |
ttgccgcccatttggatcccattatgctcgagg-attagtctccgcagttgcgcgcggaggata |
44941255 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #13
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 148 - 219
Target Start/End: Complemental strand, 48211014 - 48210943
Alignment:
| Q |
148 |
cttgccgtccatttgggtcccacaatgctcgagggattagtctccgcagttgcgcgcggaggatacccgatt |
219 |
Q |
| |
|
||||||||| |||| ||||||||||| ||||||| ||| ||||||||||||| |||||| ||||||||||| |
|
|
| T |
48211014 |
cttgccgtctatttaggtcccacaatactcgaggaattgatctccgcagttgcacgcggaagatacccgatt |
48210943 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #14
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 148 - 220
Target Start/End: Original strand, 40294699 - 40294771
Alignment:
| Q |
148 |
cttgccgtccatttgggtcccacaatgctcgagggattagtctccgcagttgcgcgcggaggatacccgattt |
220 |
Q |
| |
|
||||||| |||||| ||||||||| ||||| |||||||||||||||||||||| | |||||||||||||| |
|
|
| T |
40294699 |
cttgccgctcatttgaatcccacaatactcgaaggattagtctccgcagttgcgcacaaaggatacccgattt |
40294771 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #15
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 171 - 219
Target Start/End: Complemental strand, 43621342 - 43621294
Alignment:
| Q |
171 |
aatgctcgagggattagtctccgcagttgcgcgcggaggatacccgatt |
219 |
Q |
| |
|
||||||||||||||||||||| | |||||||||| |||||||||||||| |
|
|
| T |
43621342 |
aatgctcgagggattagtctctgtagttgcgcgcagaggatacccgatt |
43621294 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #16
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 149 - 220
Target Start/End: Original strand, 15283159 - 15283230
Alignment:
| Q |
149 |
ttgccgtccatttgggtcccacaatgctcgagggattagtctccgcagttgcgcgcggaggatacccgattt |
220 |
Q |
| |
|
|||||| ||||||||||||||||||||||||| ||||||||| | | |||| | ||||||| ||||||||| |
|
|
| T |
15283159 |
ttgccgcccatttgggtcccacaatgctcgagagattagtcttcataattgcccacggaggagacccgattt |
15283230 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #17
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 149 - 192
Target Start/End: Original strand, 15446084 - 15446127
Alignment:
| Q |
149 |
ttgccgtccatttgggtcccacaatgctcgagggattagtctcc |
192 |
Q |
| |
|
|||||||||||||||||| |||||||||||| |||||||||||| |
|
|
| T |
15446084 |
ttgccgtccatttgggtctcacaatgctcgacggattagtctcc |
15446127 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #18
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 148 - 220
Target Start/End: Original strand, 11767197 - 11767269
Alignment:
| Q |
148 |
cttgccgtccatttgggtcccacaatgctcgagggattagtctccgcagttgcgcgcggaggatacccgattt |
220 |
Q |
| |
|
||||||| ||||||| |||||||||| | || |||||||||| |||| || |||| |||||||||||||||| |
|
|
| T |
11767197 |
cttgccgcccatttgagtcccacaatatttgaaggattagtcttcgcaattacgcgtggaggatacccgattt |
11767269 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #19
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 148 - 216
Target Start/End: Original strand, 22288322 - 22288390
Alignment:
| Q |
148 |
cttgccgtccatttgggtcccacaatgctcgagggattagtctccgcagttgcgcgcggaggatacccg |
216 |
Q |
| |
|
|||| |||||||||| || |||||| ||| ||| ||||||||| ||||||| |||||||||||||||| |
|
|
| T |
22288322 |
cttgtcgtccatttgagttacacaatactcaaggaattagtctctgcagttgtgcgcggaggatacccg |
22288390 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #20
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 149 - 213
Target Start/End: Original strand, 46725513 - 46725576
Alignment:
| Q |
149 |
ttgccgtccatttgggtcccacaatgctcgagggattagtctccgcagttgcgcgcggaggatac |
213 |
Q |
| |
|
|||| |||||| ||||||| |||||||| |||||||||||||| ||||| |||||||||||||| |
|
|
| T |
46725513 |
ttgctgtccatctgggtcc-acaatgcttgagggattagtctcttcagttacgcgcggaggatac |
46725576 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0013 (Bit Score: 56; Significance: 4e-23; HSPs: 1)
Name: scaffold0013
Description:
Target: scaffold0013; HSP #1
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 157 - 220
Target Start/End: Complemental strand, 29197 - 29134
Alignment:
| Q |
157 |
catttgggtcccacaatgctcgagggattagtctccgcagttgcgcgcggaggatacccgattt |
220 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
29197 |
catttgggtcccacaatgctcgtgggattagtctccacagttgcgcgcggaggatacccgattt |
29134 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0182 (Bit Score: 55; Significance: 2e-22; HSPs: 1)
Name: scaffold0182
Description:
Target: scaffold0182; HSP #1
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 150 - 216
Target Start/End: Original strand, 26420 - 26486
Alignment:
| Q |
150 |
tgccgtccatttgggtcccacaatgctcgagggattagtctccgcagttgcgcgcggaggatacccg |
216 |
Q |
| |
|
||||| ||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
26420 |
tgccgcccatttgggtcccacaatgttcgagagattagtctccgcagttgcgcgcggaggatacccg |
26486 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 54; Significance: 6e-22; HSPs: 14)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 54; E-Value: 6e-22
Query Start/End: Original strand, 151 - 216
Target Start/End: Complemental strand, 12836948 - 12836883
Alignment:
| Q |
151 |
gccgtccatttgggtcccacaatgctcgagggattagtctccgcagttgcgcgcggaggatacccg |
216 |
Q |
| |
|
|||| ||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
12836948 |
gccgcccatttgggtcccacaatgcttgagggattagtctccccagttgcgcgcggaggatacccg |
12836883 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 153 - 215
Target Start/End: Original strand, 28099335 - 28099397
Alignment:
| Q |
153 |
cgtccatttgggtcccacaatgctcgagggattagtctccgcagttgcgcgcggaggataccc |
215 |
Q |
| |
|
|||||||||| || ||| ||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
28099335 |
cgtccatttgagttccataatgctcgagggattagtctccgcagttgcgagcggaggataccc |
28099397 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 152 - 212
Target Start/End: Original strand, 9536858 - 9536918
Alignment:
| Q |
152 |
ccgtccatttgggtcccacaatgctcgagggattagtctccgcagttgcgcgcggaggata |
212 |
Q |
| |
|
|||||||||| | | |||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
9536858 |
ccgtccatttagattccacaatgctcgagggattagtctccgcagttgcgctcggaggata |
9536918 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 150 - 216
Target Start/End: Original strand, 12411237 - 12411303
Alignment:
| Q |
150 |
tgccgtccatttgggtcccacaatgctcgagggattagtctccgcagttgcgcgcggaggatacccg |
216 |
Q |
| |
|
||||| |||||| ||||||||||||| ||||||||||||||| ||||||||||||| ||||||||| |
|
|
| T |
12411237 |
tgccgcccatttaagtcccacaatgcttgagggattagtctccacagttgcgcgcgggggatacccg |
12411303 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 150 - 220
Target Start/End: Original strand, 31412211 - 31412281
Alignment:
| Q |
150 |
tgccgtccatttgggtcccacaatgctcgagggattagtctccgcagttgcgcgcggaggatacccgattt |
220 |
Q |
| |
|
||||| |||||||||| |||||||||||||| |||||||||| ||||||||| ||||||||| ||||||| |
|
|
| T |
31412211 |
tgccgcccatttgggttccacaatgctcgagaaattagtctccacagttgcgcacggaggatatccgattt |
31412281 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 157 - 214
Target Start/End: Original strand, 21910301 - 21910357
Alignment:
| Q |
157 |
catttgggtcccacaatgctcgagggattagtctccgcagttgcgcgcggaggatacc |
214 |
Q |
| |
|
||||| ||||||||||| ||| |||||||||||||||||||||| ||||||||||||| |
|
|
| T |
21910301 |
catttaggtcccacaatactc-agggattagtctccgcagttgcacgcggaggatacc |
21910357 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #7
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 149 - 220
Target Start/End: Original strand, 278479 - 278550
Alignment:
| Q |
149 |
ttgccgtccatttgggtcccacaatgctcgagggattagtctccgcagttgcgcgcggaggatacccgattt |
220 |
Q |
| |
|
||||||||||||| |||||||||| ||| ||||||||||| | ||||||| | ||||||||||||||||| |
|
|
| T |
278479 |
ttgccgtccatttaggtcccacaaaactcaagggattagtcgtcacagttgcacacggaggatacccgattt |
278550 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #8
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 150 - 188
Target Start/End: Original strand, 423744 - 423782
Alignment:
| Q |
150 |
tgccgtccatttgggtcccacaatgctcgagggattagt |
188 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
423744 |
tgccgtccatttgagtcccacaatgctcgagggattagt |
423782 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #9
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 149 - 199
Target Start/End: Complemental strand, 21028895 - 21028845
Alignment:
| Q |
149 |
ttgccgtccatttgggtcccacaatgctcgagggattagtctccgcagttg |
199 |
Q |
| |
|
|||||| |||||||||| |||||| |||| ||||||||||||||||||||| |
|
|
| T |
21028895 |
ttgccgcccatttgggtgccacaaggctcaagggattagtctccgcagttg |
21028845 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #10
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 149 - 199
Target Start/End: Complemental strand, 21029032 - 21028982
Alignment:
| Q |
149 |
ttgccgtccatttgggtcccacaatgctcgagggattagtctccgcagttg |
199 |
Q |
| |
|
|||||| |||||||||| |||||| |||| ||||||||||||||||||||| |
|
|
| T |
21029032 |
ttgccgcccatttgggtgccacaaggctcaagggattagtctccgcagttg |
21028982 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #11
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 149 - 200
Target Start/End: Original strand, 28933226 - 28933277
Alignment:
| Q |
149 |
ttgccgtccatttgggtcccacaatgctcgagggattagtctccgcagttgc |
200 |
Q |
| |
|
|||||| |||||||||| |||||||||||||| || |||| ||||||||||| |
|
|
| T |
28933226 |
ttgccgcccatttgggttccacaatgctcgagtgaatagtatccgcagttgc |
28933277 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #12
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 156 - 220
Target Start/End: Original strand, 1534347 - 1534409
Alignment:
| Q |
156 |
ccatttgggtcccacaatgctcgagggattagtctccgcagttgcgcgcggaggatacccgattt |
220 |
Q |
| |
|
||||||| ||| |||||||||||||| ||| ||||||||||| |||||||||||| ||||||| |
|
|
| T |
1534347 |
ccatttgagtcgcacaatgctcgaggaattgatctccgcagtt--gcgcggaggatatccgattt |
1534409 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #13
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 148 - 201
Target Start/End: Original strand, 6062129 - 6062182
Alignment:
| Q |
148 |
cttgccgtccatttgggtcccacaatgctcgagggattagtctccgcagttgcg |
201 |
Q |
| |
|
|||||||| ||||||||||| |||| | |||| |||||||||| |||||||||| |
|
|
| T |
6062129 |
cttgccgttcatttgggtcctacaacgttcgatggattagtcttcgcagttgcg |
6062182 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #14
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 158 - 215
Target Start/End: Complemental strand, 15614617 - 15614560
Alignment:
| Q |
158 |
atttgggtcccacaatgctcgagggattagtctccgcagttgcgcgcggaggataccc |
215 |
Q |
| |
|
||||| |||||||||||||| ||| |||||||| | |||||||| | ||||||||||| |
|
|
| T |
15614617 |
atttgagtcccacaatgctctaggaattagtcttcacagttgcgtgtggaggataccc |
15614560 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0009 (Bit Score: 48; Significance: 2e-18; HSPs: 1)
Name: scaffold0009
Description:
Target: scaffold0009; HSP #1
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 148 - 215
Target Start/End: Complemental strand, 27279 - 27212
Alignment:
| Q |
148 |
cttgccgtccatttgggtcccacaatgctcgagggattagtctccgcagttgcgcgcggaggataccc |
215 |
Q |
| |
|
||||||| |||||||| || ||| ||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
27279 |
cttgccgcccatttggatctcacgatgctcgagggattagtcttcgcagttgcgcgcggaggataccc |
27212 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0071 (Bit Score: 36; Significance: 0.00000000003; HSPs: 1)
Name: scaffold0071
Description:
Target: scaffold0071; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 149 - 192
Target Start/End: Complemental strand, 16108 - 16065
Alignment:
| Q |
149 |
ttgccgtccatttgggtcccacaatgctcgagggattagtctcc |
192 |
Q |
| |
|
|||||||||||||||||| |||||||||||| |||||||||||| |
|
|
| T |
16108 |
ttgccgtccatttgggtctcacaatgctcgacggattagtctcc |
16065 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University