View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2605_high_42 (Length: 289)
Name: NF2605_high_42
Description: NF2605
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2605_high_42 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 183; Significance: 5e-99; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 183; E-Value: 5e-99
Query Start/End: Original strand, 52 - 271
Target Start/End: Complemental strand, 52233969 - 52233750
Alignment:
| Q |
52 |
ttactcccgagtgtttcttttctttttgttgtgaggaaagtatactcgtattgcacnnnnnnngtttatgggattgtgaacttcattttcggccaaggat |
151 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| | ||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52233969 |
ttactcccgagtgtttcttttctttttgttgtgaggaaagtatactctaaatgcactttttttgtttatgggattgtgaacttcattttcggccaaggat |
52233870 |
T |
 |
| Q |
152 |
gatgtcgcttagattttactcctacagtgtgcattacctccactaataatcgagaaatgttattttcttaacagaccctctttatactgctttccatgac |
251 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52233869 |
gatgtcgcttagattttactcctacagtgtgcattacctccactaataattgagaaatgttattttcttaacagaccctctttatactgctttccatgac |
52233770 |
T |
 |
| Q |
252 |
gatgaatggggtgttccagt |
271 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
52233769 |
gatgaatggggtgttccagt |
52233750 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University