View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2605_high_52 (Length: 239)
Name: NF2605_high_52
Description: NF2605
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2605_high_52 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 89; Significance: 5e-43; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 89; E-Value: 5e-43
Query Start/End: Original strand, 122 - 222
Target Start/End: Original strand, 8272423 - 8272523
Alignment:
| Q |
122 |
caaaatcatcgtgatattgtagaagcacaagttgtagctttgcatttgtcgcacctttgatgtgctcttaaacacgaaaacaatgaccatacaattattg |
221 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||| |
|
|
| T |
8272423 |
caaaatcaccgtgatattgtagaagcacaagttgtagctttgcatttgtcgcacctttgatgtgctcttaaacatgaaaacaatgacgatacaattattg |
8272522 |
T |
 |
| Q |
222 |
t |
222 |
Q |
| |
|
| |
|
|
| T |
8272523 |
t |
8272523 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 62; E-Value: 6e-27
Query Start/End: Original strand, 1 - 74
Target Start/End: Original strand, 8271932 - 8272005
Alignment:
| Q |
1 |
ttacaacaagaatggactccatagttgaaaattgattgtgccctagtaaagccactgcaaatttatcattgttg |
74 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||| |||| ||||||||||||||||||||||||||| |
|
|
| T |
8271932 |
ttacaacaagaatggactccattgttgaaaattgattgtgctctagcaaagccactgcaaatttatcattgttg |
8272005 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University