View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2605_low_31 (Length: 352)
Name: NF2605_low_31
Description: NF2605
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2605_low_31 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 284; Significance: 1e-159; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 284; E-Value: 1e-159
Query Start/End: Original strand, 1 - 352
Target Start/End: Complemental strand, 33350586 - 33350234
Alignment:
| Q |
1 |
taattttttatggagctatatccgatctaactcactttgtaatttgttcaactggagatgggtcaatgattcgaatttaattttattttgtgaatggtaa |
100 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
33350586 |
taattttttatggagctatttccgatctaactcactttgtaatttgttcaactggagatgggtcaatgattcgaatttaattttattttgtgaatgataa |
33350487 |
T |
|
| Q |
101 |
atgttagatttttgttttataattgcaaatggcatggatcatgtaaggttttcttcatggtttaatttttgctatgtgtannnnnnnagttgaaactttg |
200 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||| ||||||||||||| |
|
|
| T |
33350486 |
atgttagatttttgttttgtaattgcaaatggcatggatcatgtaaggttttctgcatggtttaatttttgctatctgtatttttttagttgaaactttg |
33350387 |
T |
|
| Q |
201 |
ctatgtatgtcgt-acttggagtgaggatgtgtgatgattgtcgtcggaaaaacaatatggatcgatgcctatggatgacggttaatagaaggtgaaatt |
299 |
Q |
| |
|
|||| |||||||| | |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
33350386 |
ctatatatgtcgtaaactggagtgaggatgtgtgatgattgtcgtcggaaaaacaatatggatcggtgcctatggatgacggttaatagaaggtgaaatt |
33350287 |
T |
|
| Q |
300 |
gtcgtaacgtgggtagcaattgtggctgagatatgggcatccaagcccccttt |
352 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
33350286 |
gtcgtaacgtgggtagcgattgtggctgagatatgggcatccaagcccccttt |
33350234 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University