View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2605_low_41 (Length: 301)
Name: NF2605_low_41
Description: NF2605
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2605_low_41 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 177; Significance: 2e-95; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 83 - 291
Target Start/End: Original strand, 28203373 - 28203579
Alignment:
| Q |
83 |
atttgttgtgtttgcatctattgattagggagaagcaaagccaagacacgtgtgattcacagaaactctaagttatggttgagtgacacgcaactatatg |
182 |
Q |
| |
|
|||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28203373 |
atttgttgtgtttgcatc-attgataagggagaagcaaagccaagacacgtgtgattcacagaaactctaagttatggttgagtgacacgcaactatatg |
28203471 |
T |
|
| Q |
183 |
tgttggacaaatttaacatattattgacaacaaagaatattacttattttatctgtcttattatatgcctagtttaagattacacactacttttaaaaaa |
282 |
Q |
| |
|
||||||||||| |||||||||||||||||||| | |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
28203472 |
tgttggacaaa-ttaacatattattgacaacacaaaatattacttattttatctgtcttattataagcctagtttaagattacacactacttttaaaaaa |
28203570 |
T |
|
| Q |
283 |
taccctatg |
291 |
Q |
| |
|
||||||||| |
|
|
| T |
28203571 |
taccctatg |
28203579 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University