View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2605_low_47 (Length: 280)
Name: NF2605_low_47
Description: NF2605
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2605_low_47 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 248; Significance: 1e-138; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 248; E-Value: 1e-138
Query Start/End: Original strand, 15 - 270
Target Start/End: Original strand, 1025574 - 1025829
Alignment:
| Q |
15 |
aaatttatcaaacaaagtttaaggattggaagaaacttgagtacaactcgctacaaatggatttgaagaagcaaagatttggttcaagtaattcaacaac |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1025574 |
aaatttatcaaacaaagtttaaggattggaagaaacttgagtacaactccctacaaatggatttgaagaagcaaagatttggttcaagtaattcaacaac |
1025673 |
T |
|
| Q |
115 |
tcaaaccataagattaggtagaagctacacaaaaccacactatcaaagctaccatgatgggacaaaaccagtgtggcaaaaagtttggaaaaaacttaag |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1025674 |
tcaaaccataagattaggtagaagctacacaaaaccacactatcaaagctaccatgatgggacaaaaccagtgtggcaaaaagtttggaaaaaacttaag |
1025773 |
T |
|
| Q |
215 |
agagacaagaagaaaatctttggctcaactccaacaataggaggtatttatgatga |
270 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
1025774 |
agagacaagaagaaaatctttggctcaactccaacaatagaaggtatttatgatga |
1025829 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University