View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2605_low_48 (Length: 277)
Name: NF2605_low_48
Description: NF2605
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2605_low_48 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 221; Significance: 1e-121; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 221; E-Value: 1e-121
Query Start/End: Original strand, 16 - 261
Target Start/End: Original strand, 51222389 - 51222634
Alignment:
| Q |
16 |
tatgataagatagtcttttgggnnnnnnncccatgttttcagttggatgtatggttgattttgtcttttcattgtccattctctttgtcttttgagatgc |
115 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51222389 |
tatgataagatagtcttttggttttttcccccatgttttcagttggatgtatggttgattttgtcttttcattgtccattctctttgtcttttgagatgc |
51222488 |
T |
 |
| Q |
116 |
ggaagtgttggtaatttgaaagtcacaaaatggtgatattttctctcgtaagttggtgaatattgaggacttagtgaagcatattaatatctcttctcgg |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51222489 |
ggaagtgttggtaatttgaaagtcacaaaatggtgatattttctctcgtaagttggtgaatattgaggacttagtgaagcatattaatatctcttctcgg |
51222588 |
T |
 |
| Q |
216 |
aggtggatttcaggatattcttgtactttttatgagtggttaatgg |
261 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51222589 |
aggtggatttcaggatattcttgtactttttatgagtggttaatgg |
51222634 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 57 - 95
Target Start/End: Original strand, 51222689 - 51222727
Alignment:
| Q |
57 |
gttggatgtatggttgattttgtcttttcattgtccatt |
95 |
Q |
| |
|
||||||| |||||||||||||||||||||||||| |||| |
|
|
| T |
51222689 |
gttggatttatggttgattttgtcttttcattgttcatt |
51222727 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University