View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2605_low_50 (Length: 267)
Name: NF2605_low_50
Description: NF2605
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2605_low_50 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 43 - 254
Target Start/End: Original strand, 2223111 - 2223322
Alignment:
| Q |
43 |
gtgcggttatgatttctttgcggtttatgacggtcatggtggtatgacggtggcgaatgcttgccgtgataggctgcacttgttgttggcggaggaagtg |
142 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
2223111 |
gtgcggttatgatttctttgcggtttatgacggtcatggtggtatgacggtggcgaatgcttgccgtgataggttgcacttgttgttggcggaggaagtg |
2223210 |
T |
|
| Q |
143 |
aaggagggtaggaggaatcatggattggattggtgtgaagctatgtgttcttgttttatgaaaatggatagtgaaattggagtcggtggaagttgtggtg |
242 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2223211 |
aaggagggtaggaggaatcatggattggattggtgtgaagctatgtgttcttgttttatgaagatggatagtgaaattggagtcggtggaagttgtggtg |
2223310 |
T |
|
| Q |
243 |
atgaggttgatg |
254 |
Q |
| |
|
|||||||||||| |
|
|
| T |
2223311 |
atgaggttgatg |
2223322 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University