View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2605_low_53 (Length: 263)

Name: NF2605_low_53
Description: NF2605
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2605_low_53
NF2605_low_53
[»] chr7 (2 HSPs)
chr7 (121-255)||(6729854-6729988)
chr7 (139-228)||(42607352-42607441)
[»] chr1 (1 HSPs)
chr1 (121-200)||(45922489-45922568)
[»] chr8 (1 HSPs)
chr8 (121-255)||(35943294-35943430)


Alignment Details
Target: chr7 (Bit Score: 54; Significance: 4e-22; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 121 - 255
Target Start/End: Original strand, 6729854 - 6729988
Alignment:
121 gaacaacaattgctcttgattattaatataatttcaccactacctttcataannnnnnnatgtgtttttgctttcgatttaatgaatgaaagaaaggact 220  Q
    |||||||| ||||| |||||| ||||||||||| || |||||||||||||||        |  ||||||||||||||||||||||||||| ||||| |||    
6729854 gaacaacacttgctattgattgttaatataattccatcactacctttcataattttttttttagtttttgctttcgatttaatgaatgaatgaaagaact 6729953  T
221 tttgcagtgagtcatgtgagaggaacttgatgatg 255  Q
    || | ||||||||| |||| |||||||| ||||||    
6729954 ttcgtagtgagtcaagtgaaaggaactttatgatg 6729988  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 139 - 228
Target Start/End: Complemental strand, 42607441 - 42607352
Alignment:
139 attattaatataatttcaccactacctttcataannnnnnnatgtgtttttgctttcgatttaatgaatgaaagaaaggacttttgcagt 228  Q
    ||||||||||| ||| |||||||||||||||||        ||||||||||||||| ||||| ||||||||||||||  |||||||||||    
42607441 attattaatatcattccaccactacctttcatatttcttttatgtgtttttgctttggattttatgaatgaaagaaaaaacttttgcagt 42607352  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 51; Significance: 3e-20; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 121 - 200
Target Start/End: Complemental strand, 45922568 - 45922489
Alignment:
121 gaacaacaattgctcttgattattaatataatttcaccactacctttcataannnnnnnatgtgtttttgctttcgattt 200  Q
    ||||||||||||||||||||||||| ||||||| ||||||||||||||||||       |||||||||||||||||||||    
45922568 gaacaacaattgctcttgattattattataattccaccactacctttcataatttatttatgtgtttttgctttcgattt 45922489  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 49; Significance: 4e-19; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 121 - 255
Target Start/End: Complemental strand, 35943430 - 35943294
Alignment:
121 gaacaacaattgctcttgattattaatataatttcaccactacctttcataannnnnnnatgt--gtttttgctttcgatttaatgaatgaaagaaagga 218  Q
    |||||||| ||||| |||||| ||||||||||| || ||||||||||||||         | |  ||||||||||||||||||||||||||||||||| |    
35943430 gaacaacacttgctattgattgttaatataattccatcactacctttcatatttttttttttttagtttttgctttcgatttaatgaatgaaagaaagaa 35943331  T
219 cttttgcagtgagtcatgtgagaggaacttgatgatg 255  Q
    |||| | ||||||||| |||| |||||||| ||||||    
35943330 ctttcgtagtgagtcaagtgaaaggaactttatgatg 35943294  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University