View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2605_low_54 (Length: 261)
Name: NF2605_low_54
Description: NF2605
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2605_low_54 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 139; Significance: 8e-73; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 139; E-Value: 8e-73
Query Start/End: Original strand, 58 - 246
Target Start/End: Complemental strand, 39385148 - 39384960
Alignment:
| Q |
58 |
atggaatttagacttctttctccgtgccaaagtctggagctgagtacctcaaagttgaagaacaatcttacaaccaagtnnnnnnnctagcaggaattca |
157 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||| |
|
|
| T |
39385148 |
atggaatttagacttctttctccgtgccaaagtctggagctgagtacctcaaagttgaagaacaatcttacaaccaaataaaaaaactagcaggaattca |
39385049 |
T |
|
| Q |
158 |
gacttctttgggtgttggatgaaatattttctgaaaatcacttcttcccttcacttggannnnnnnattaaaacaaagtccacattcat |
246 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
39385048 |
gacttctttgggtgttggatggaatattttctgaaaatcacttcttcccttcacttggatttttttattaaaacaaagtccacattcat |
39384960 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 67 - 136
Target Start/End: Original strand, 39180566 - 39180635
Alignment:
| Q |
67 |
agacttctttctccgtgccaaagtctggagctgagtacctcaaagttgaagaacaatcttacaaccaagt |
136 |
Q |
| |
|
||||||||||||| ||||||||||||||| ||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
39180566 |
agacttctttctcagtgccaaagtctggaactgagtacctcaaagttgaagaataatcttacaaccaagt |
39180635 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University