View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2605_low_57 (Length: 245)
Name: NF2605_low_57
Description: NF2605
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2605_low_57 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 138; Significance: 3e-72; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 13 - 220
Target Start/End: Complemental strand, 3906988 - 3906782
Alignment:
| Q |
13 |
aatataatcgtaagaccagtataaaagttcagttgatagaaagttgattcatattttaaaagaacgtgatttcaatgtattttggannnnnnncgataag |
112 |
Q |
| |
|
||||||||| |||| | | |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||| | |
|
|
| T |
3906988 |
aatataatcataaggctaatataaaagttcagttgatagaaagttgattcatattttaaaagaacgtaatttcaatgtattttggatttttt-cgatcaa |
3906890 |
T |
 |
| Q |
113 |
tgatttgtctttgttagtgttttgagtcccgagatctactttaacctcaccgccttagcgagtctacatctattctactcattgaaaccttttgttatgt |
212 |
Q |
| |
|
| |||||||||| |||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3906889 |
taatttgtctttattagtgttttgagttccgagatctactctaacctcaccgccttagcgagtctacatctattctactcattgaaaccttttgttatgt |
3906790 |
T |
 |
| Q |
213 |
caagtaat |
220 |
Q |
| |
|
|||||||| |
|
|
| T |
3906789 |
caagtaat |
3906782 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University