View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2605_low_62 (Length: 235)
Name: NF2605_low_62
Description: NF2605
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2605_low_62 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 166; Significance: 6e-89; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 166; E-Value: 6e-89
Query Start/End: Original strand, 7 - 221
Target Start/End: Complemental strand, 4473866 - 4473652
Alignment:
| Q |
7 |
gtattagatgaatgttttattaatcaatggtcaaaattaattagttttatatttcatcttatacnnnnnnncatatagaatcagctcatgagttggacaa |
106 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
4473866 |
gtattcgatgaatgttttattaatcaatggtcaaaattaattagttttatatttcatcttatacaaaaaaacatatagaatcagctcatgagttggacaa |
4473767 |
T |
|
| Q |
107 |
tataatagactataatttagaatggatggatgaagaagttagatgatatttaatcaaaacaattttgacaattcattctttnnnnnnnntatatattggc |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
4473766 |
tataatagactataatttagaatggatggatgaagaagttagatgatatttaatcaaaacaattttgacaattcattctttaaaaaaaatatatattggc |
4473667 |
T |
|
| Q |
207 |
cattgatgtacattt |
221 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
4473666 |
cattgatgtacattt |
4473652 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University