View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2605_low_63 (Length: 234)
Name: NF2605_low_63
Description: NF2605
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2605_low_63 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 176; Significance: 6e-95; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 176; E-Value: 6e-95
Query Start/End: Original strand, 18 - 222
Target Start/End: Complemental strand, 34835645 - 34835441
Alignment:
| Q |
18 |
tatagatgggcttctgtaagtacatttcatgctttacacnnnnnnncttcaatttattaagatcaagatgatttcaattgattcatttgttgaacagatg |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34835645 |
tatagatgggcttctgtaagtacatttcatgctttacactttttttcttcaatttattaagatcaagatgatttcaattgattcatttgttgaacagatg |
34835546 |
T |
|
| Q |
118 |
cagaccaagggagatgctttgcaaacagaatctcaactgctgagtacatttgattatgcttggaacacaattaataacggtccacgacgtccaggtgata |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||| |
|
|
| T |
34835545 |
cagaccaagggagatgctttgcaaacagaatctcaactgctgagtacatttgattatgcttggaacacaattaataacggtccacggcgtccgggtgata |
34835446 |
T |
|
| Q |
218 |
ttctt |
222 |
Q |
| |
|
||||| |
|
|
| T |
34835445 |
ttctt |
34835441 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 107 - 188
Target Start/End: Original strand, 35336285 - 35336366
Alignment:
| Q |
107 |
ttgaacagatgcagaccaagggagatgctttgcaaacagaatctcaactgctgagtacatttgattatgcttggaacacaat |
188 |
Q |
| |
|
||||||||||||| | |||||||||| || ||||||||| || ||||| ||||||||||||||||| ||||||||||| |
|
|
| T |
35336285 |
ttgaacagatgcaaaatgagggagatgccctgagaacagaatcacagctgcttagtacatttgattatgcatggaacacaat |
35336366 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University