View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2605_low_66 (Length: 211)
Name: NF2605_low_66
Description: NF2605
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2605_low_66 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 176; Significance: 5e-95; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 176; E-Value: 5e-95
Query Start/End: Original strand, 18 - 197
Target Start/End: Complemental strand, 40376199 - 40376020
Alignment:
| Q |
18 |
ataaaaacaaatgaaaatcatcactcaccattagtcccaagaacatgcagagcaactacaagatcaccaggttgagcaactttaaccaaagcccaagtaa |
117 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40376199 |
ataaaaacaaatgaaaattatcactcaccattagtcccaagaacatgcagagcaactacaagatcaccaggttgagcaactttaaccaaagcccaagtaa |
40376100 |
T |
 |
| Q |
118 |
gaagctctttgcttggtgaatccattttcactcccaccaccaccgtccggccatcggagccaccctcatcacaagttttt |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40376099 |
gaagctctttgcttggtgaatccattttcactcccaccaccaccgtccggccatcggagccaccctcatcacaagttttt |
40376020 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 56 - 108
Target Start/End: Complemental strand, 10257668 - 10257616
Alignment:
| Q |
56 |
aagaacatgcagagcaactacaagatcaccaggttgagcaactttaaccaaag |
108 |
Q |
| |
|
||||||||| ||||||| | ||||||||||||||||||||| || ||||||| |
|
|
| T |
10257668 |
aagaacatgaagagcaagaataagatcaccaggttgagcaacattgaccaaag |
10257616 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University