View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2606_high_19 (Length: 212)

Name: NF2606_high_19
Description: NF2606
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2606_high_19
NF2606_high_19
[»] chr1 (1 HSPs)
chr1 (1-205)||(32372407-32372608)


Alignment Details
Target: chr1 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 1 - 205
Target Start/End: Complemental strand, 32372608 - 32372407
Alignment:
1 cttaccttcagctgaggaaccgtcgccttaagagacccctaattaggcaacattccgctaagaggaataaggggaatgatggaagccctaaatccccaat 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
32372608 cttaccttcagctgaggaaccgtcgccttaagagacccctaattaggcaacattccgctaagaggaataaggggaatgatggaagccctaaatccccaat 32372509  T
101 tggggattcaactgctgaagagaaaactgttcagaagagtcctgagcctgaaaatgctgaatttggggagaatgctgaggaggatgctgagaggtgggta 200  Q
    |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||   ||||||||||||||||||||    
32372508 tgggaattcaactgctgaagagaaaactgttcagaagagtcctgagcctgaaaatgctgaatttggggtgaatgctg---aggatgctgagaggtgggta 32372412  T
201 tttcg 205  Q
    |||||    
32372411 tttcg 32372407  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University