View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2606_low_12 (Length: 337)

Name: NF2606_low_12
Description: NF2606
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2606_low_12
NF2606_low_12
[»] chr1 (1 HSPs)
chr1 (18-72)||(32372108-32372162)


Alignment Details
Target: chr1 (Bit Score: 55; Significance: 1e-22; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 18 - 72
Target Start/End: Original strand, 32372108 - 32372162
Alignment:
18 aattgaacaaaacatcatgaatcccagaatcaaattcatgttctgctttgttcta 72  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||    
32372108 aattgaacaaaacatcatgaatcccagaatcaaattcatgttctgctttgttcta 32372162  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University